Need help with heteroduplex in DNA problem!!!!

Ezra Schildkraut ezra at UNM.EDU
Fri Sep 11 16:07:28 EST 1998


I am trying to figure out the possible tertiary structures formed by the
following sequence of DNA:

5'TTTTTAAAAATTTTTGGGGGGGGGG3'
3'AAAAATTTTTAAAAACCCCCCCCCC5'

   I also need help figuring out methods to distinguish between the
different structures. The techniques I have thought about are Tm
experiments, S1 nuclease, T4 endo VII, SSCP, and possible some
flourescence. If you have any other suggestions or some possible
references to the procedures above can you please send them my way.
Thanks alot.

Ezra




More information about the Cellbiol mailing list