Corbett Research FTS-1 Thermal Sequencer

Chih-L Han jesehcl at mac.com
Thu Jan 13 05:05:23 EST 2000


 Dear News Readers,

Anyone still using using the Corbett Research FTS-1 Thermal Sequencer? Can
you advice where I can get the PCR capillaries and plastic seal plugs?

Thank you very much for your assistance in advance.

please reply to jessehcl at mac.com
          _____
           |_|*     Chih-L Han MD
         {~._.~}       http://macbiomed.cjb.net/
          ( Y )     mailto:jessehcl at mac.com
         ()~*~U)    ICQ:7281420
         (_)-(_)    efax://+1 707 929 0531
            AGCTACGTAAATAATCCTACGGGCACATTGGCAATTGCGTAACG





More information about the Cellbiol mailing list