GenMark Gene Recognition Server Update (Repost)
James D. McIninch
gt1619a at prism.gatech.edu
Mon Aug 30 10:51:58 EST 1993
[ I have been asked to repost our original notice concerning the newest
version of the GenMark genetic recognition software. This server identifies
genes in novel DNA sequences based on observed Markov chain statistics of
known DNA sequences ... ]
------------------------------------------------------------------------------
--- GenMark Server *** ANNOUNCEMENT August 20, 1993
--- genmark at ford.gatech.edu
We are pleased to announce that the GenMark server has been
updated. A number of new features have been added and previously available
features have been improved.
The GenMark server provides an E-Mail based gene finding service using
the GenMark algorithm (based on non-stationary Markov chain models and
maximum likelihood approach) which was developed at the Georgia Institute of
Technology (Atlanta, GA) and at the Institute of Molecular Genetics (Moscow),
see references below .
The GenMark server accepts messages containing DNA sequences in a
simple format. You may specify the species name and parameters affecting
the level of complexity of the analysis.
In its most simple form, a GenMark query may look like this:
% mail genmark at ford.gatech.edu
Subject: genmar
data
acatgcatcgatcatcagcatcagcatatacgatcagctacatcgatcatgaacgttacgtga
atctagctcagcatgcatcagtcagtcatgcatgcatgatgcatatgcatactgctatgcatc
atcgagctagcatacgatcgctcgccctagctaaagctagcatagcgatcg
.
EOT
(in this case the analysis will be done with using fifth order Markov chain
models of coding and noncoding regions of E.coli DNA. Using the default
settings, GenMark predicts the coding potential of 96bp fragments with about a
4% false negative rate and a 3% false positive rate).
Initially, we suggest that you send a sequence with which you are already
familiar with the content. This should provide an illustration of how GenMark
works and what the results may look like.
SUMMARY OF ANALYSIS FEATURES
--------------------------------------------------------------------------------
- GenMark automatically responds with a list of DNA sequence regions
predicted as protein-coding in a certain reading frame.
- GenMark provides an option to produce a graphical representation of the
sequence analysis. It is generated as a PostScript file (that you can
print on a laser printer) which indicates the coding potential of the
sequence in each of six frames. The improved output denotes those regions
which are predicted as coding with grey horizontal bars .
(!) The features mentioned above were designed originally for the E.coli
genome. Thus, they have been used primarily by researchers working with
E.coli DNA in the US, Japan and France.
- NEW OPTION: The immediate comparison of regions predicted as protein-coding
with a protein and DNA sequence databases by sending to a BLAST server
(NCBI/NIH). The results of the BLAST search for sequence similarities are
sent to you directly. (Results, from GenMark and BLAST, should be back to
you in about 20 minutes).
- NEW OPTION: The analysis of human sequences (which is currently not very
sophisticated; exons shorter than 60bp may be missed).
- NEW OPTION: Search for horizontally transferred genes and intervening
sequences in E. coli as well as assessment of gene expression level.
FOR MORE INFORMATION
--------------------------------------------------------------------------------
You may retrieve a copy of the new instructions and explanation of
features for using GenMark by sending an E-Mail message with the word
"help" in the subject or body of the letter to:
genmark at ford.gatech.edu
If you would like to contact us personally, you may do so by sending
electronic mail to Dr. M. Borodovsky at:
mb56 at prism.gatech.edu
... or to J. McIninch at:
gt1619a at prism.gatech.edu
REFERENCES
--------------------------------------------------------------------------------
Borodovsky M, McIninch J. (1993) GENMARK: Parallel Gene Recognition for Both
DNA strands, Computers & Chemistry, 17, N2, 123-133.
Borodovsky M, McIninch J. (1993) Prediction of Gene Locations Using DNA Markov
Chain Models. Proceedings of the Second International Conference on
Supercomputing, Bioinformatics and Complex Genome Analysis. St. Petersburg,
FL, 199, World Scientific, 231-248.
Borodovsky, M.Yu., Sprizhitsky, Yu.A., Golovanov, E.I., Alexandrov, A.A.,
(1986) Statistical Patterns in the Primary Structure of the Functional
Regions of the Escherichia Coli Genome. III. Computer Recognition of
Protein Coding Regions. Molecular Biology, 20, 1144-1150.
--------------------------------------------------------------------------------
James D. McIninch |
gt1619a at hydra.gatech.edu | "Designing tomorrow's engineers today."
School of Applied Biology |
Georgia Institute of Technology |
--------------------------------------------------------------------------------
More information about the Comp-bio
mailing list