Python module for DNA to amino acid and reverse complement translation.
Alex
cut_me_out at hotmail.com
Fri Sep 1 21:46:54 EST 2000
Hi. Here is a python wrapper around some simple C functions that
translate DNA sequences into amino acid residues and give their reverse
complements. I guess it's something like 10 times faster than the pure
python versions, but I haven't done any benchmarking.
No doubt there is already a module out there that does these things.
Apologies to whoever's work I'm duplicating.
Use this any way you see fit. Let me know if you have any problems with
it, but of course there's no warranty.
You can get it at
http://puffin.lcs.mit.edu:8080/sequences.tgz
You need Distutils to install it, at the moment. You can get that at
http://www.python.org/sigs/distutils-sig/download.html
...or just be an instance of whichever gender identity you atavistically
associate with intelligence and courage, and upgrade to the latest
version of python2.0.
Once you have a python with Distutils in it and have downloaded
sequences.tgz, untar it and cd into the sequencees directory. Then run
the command python setup.py install, and you should be all set. Then
you can do things like
Python 2.0b1 (#98, Aug 30 2000, 19:11:17) <snip>
Copyright 1991-1995 Stichting Mathematisch Centrum, Amsterdam
Copyright 1995-2000 Corporation for National Research Initiatives (CNRI)
>>> import sequences
>>> sequences.translate('ATATGTACTCCCATGGGGACAAATATCCTTCTGAGGGGCCACAGTCATCAC')
'ICTPMGTNILLRGHSHH'
>>> sequences.reverse_complement('ATATGTACTCCCATGGGGACAAATATCCTTCTGA')
'TCAGAAGGATATTTGTCCCCATGGGAGTACATAT'
>>>
Alex.
--
The chain of destiny can only be grasped one link at a time.
-- Sir Winston Churchill
More information about the Comp-bio
mailing list