Tolias ovarian cDNA library entry in DIN

Peter Tolias tolias at PHRI.NYU.EDU
Fri Apr 8 10:26:09 EST 1994


Updated DIN ovarian cDNA library information

-----------------------------------------------------------------------------

--Peter Tolias, Public Health Research Institute, 455 First Ave.,
New York, New York, 10016 USA  Phone: 212-578-0815  FAX:
212-578-0804  Email: tolias at phri.nyu.edu

Vector/Insertion/Complexity/mRNA source
lambda gt22A/SalI-NotI/5x10[5]/Canton S ovaries, stages 1-14

The available amplified aliquots of the Tolias ovarian gt22A directional
cDNA library were titred at 3 x 10(8) pfu/ml (99% inserts) before freezing.
The original complexity of this sample was 500,000 independent clones
(99.7% inserts).  The 5' end has unique sites for EcoRI and SalI
(GAATTCGTCGACCCACGCGTCCG), the 3' end has a unique NotI site. Use a fresh
Y1090 O/N grown in LB amp (50 ug/ml),  0.2% maltose and 10 mM MgSO4 as
recommended by most protocols.  If you want to screen this library by PCR,
I suggest that you use a small fraction of this aliqout to reamplify and
use only reamplified samples for PCR.
     This library has been widely distributed in the USA, Canada and
Europe.  To conserve the remaining aliquots, please check oogenesis labs in
your area first before requesting it.  If it is not available, please send
us a Federal Express number to facilitate shipment.  When you receive the
library, divide it into 50 ul aliquots in siliconized microfuge tubes, add
one drop of chloroform, store one of the aliqouts at 4 deg C and freeze the
rest at -70 deg C.  When a frozen aliquot is required, thaw, use and store
at 4 deg C but do not freeze again.

Reference:
Stroumbakis, N.D., Li, Z. and Tolias, P.P. (1994).  RNA- and
single-stranded DNA-binding (SSB) proteins expressed during Drosophila
melanogaster  oogenesis: a homolog of bacterial and eukaryotic
mitochondrial SSBs.  Gene  in press.









More information about the Dros mailing list