CaSpeR vector sequence ?

S. S.
Fri Jun 2 20:53:40 EST 1995


In article <shall-0206951623100001 at macg203g.bio.purdue.edu> shall at bilbo.bio.purdue.edu (Purdue Neuroscience) writes:
>In article <1995Jun2.141443 at eros.embl-heidelberg.de>,
>uetz at embl-heidelberg.de (Peter Uetz) wrote:
>
>> Does anybody have the 
>> 
>> DNA sequence of the CaSpeR vector or of derivatives of it ?
>> 
>> 
>> Peter Uetz (UETZ at EMBL-Heidelberg.de)
>
>Try Vince Pirrotta or John Tamkun.  The CaSpeR, CoSpeR, and cosPneo 
>vectors were contructed by Pirrotta, and many of the Drosophila libraries 
>using them were made by Tamkun.
>
>Vincenzo Pirrotta
>Univ Geneva, Geneva, , SWITZERLAND
>Dept Zoology, Sciences III
>Univ Geneva
>30 quai Ernest Ansermet
>Geneva, SWITZERLAND CH-1211
>e-mail: pirrotta at sc2a.unige.ch
>
>
>John W Tamkun, University of California, Santa Cruz, CA, USA
>Dept Biology
>University of California
>323 Sinsheimer Labs, Room 323
>Santa Cruz, CA 95060
>e-mail: tamkun at orchid.ucsc.edu
>office_phone   : 408-459-3179
>lab_phone      : 408-459-3440
>
>Stephen Hall
>Purdue Neuroscience


Below is the message, including the sequence, which I saved some
time ago.  Cheers.  Slawek.

Path: newshost.anu.edu.au!harbinger.cc.monash.edu.au!bunyip.cc.uq.oz.au!munnari.oz.au!spool.mu.edu!howland.reston.ans.net!vixen.cso.uiuc.edu!sdd.hp.com!saimiri.primate.wisc.edu!news.doit.wisc.edu!avery.genetics.wisc.edu!user
From: wrengels at facstaff.wisc.edu (Bill Engels)
Newsgroups: bionet.drosophila
Subject: pP[CaSpeR] sequence
Followup-To: bionet.drosophila
Date: Tue, 05 Apr 1994 16:08:31 -0500
Organization: University of Wisconsin
Lines: 154
Message-ID: <wrengels-050494160831 at avery.genetics.wisc.edu>
NNTP-Posting-Host: avery.genetics.wisc.edu

    Several weeks ago I mentioned in this newsgroup that we have a
pieced-together sequence of the P[CaSpeR] vector. There were many requests
for this sequence, and it will eventually be placed in FlyBase. 

    Meanwhile, the sequence appended to this note. Those of you who
received a CaSpeR sequence from me by e-mail should replace it with this
one -- some mistakes have been corrected, and some guessed-at parts have
been replaced by actual sequence data.

             Bill Engels
             5 April 1994

\\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\ /X\
 \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \X/ \
William R. Engels                     :     WREngels at facstaff.wisc.edu
Genetics Department, 445 Henry Mall   :         office: (608) 263-2213
University of Wisconsin               :            lab: (608) 262-5578
Madison, WI  53706                    :            FAX: (608) 262-2976
----------------------------------------------------------------------
DNA sequence  pP[CaSpeR]   7742  b.p. complete sequence

Reference: Pirrotta, V., 1988  Vectors for P-mediated transformation in
Drosophila. Biotechnology. 10: 437-456.

This is the entire circular plasmid sequence, starting with the P 3' end. 
The P[CaSpeR] transposon itself is in bp 1 -  4982
The white gene is in 5' to 3' orientation.

lower case bases were confirmed by sequencing, and the rest were 
assumed from published sequences of P, white, and pUC.

Sequencing was done by Greg Gloor, Dena Johnson-Schlitz and Nadine
Nassif in the Engels lab.
...
CATGATGAAATAACATAAGGTGGTCCCGTCGGCAAGAGACATCCACTTAACGTATGCTTGCAATA
AGTGCGAGTGAAAGGAATAGTATTCTGAGTGTCGTATTGAGTCTGAGTGAGACAGCGATATGATT
GTTGATTAACCCTTAGCATGTCCGTGGGGTTTGAATTAACTCATAATATTAATTAGACGAAATTA
Tttttaaagttttatttttaataatttgcgagtacgcaaagcttggctgcaggtcgactctagag
gatccccgggcgagctcgaattctagtatgtatgtaagttaataaaacccatttttgcggaaagt
agataaaaaaaacattttttttttttactgcactggatatcattgaacttatctgatcagtttta
aatttacttcgatccaagggtatttgatgtaccaggttctttcgattacctctcactcaaaatga
cattccactcaaagtcagcGCTGTTTGCCTCCTTCTCTGTCCACAGAAATATCGCCGTCTCTTTC
GCCGCTGCGTCCGCTATCTCTTTCGCCACCGTTTGTAGCGTTACCTAGCGTCAATGTCCGCCTTC
AGTTGCACTTTGTCAGCGGTTTCGTGACGAAGCTCCAAGCGGTTTACGCCATCAATTAAACACAA
AGTGCTGTGCCAAAACTCCTCTCGCTTCTTATTTTTGTTTGTTTTTTGAGTGATTGGGGTGGTGA
TTGGTTTTGGGTGGGTAAGCAGGGGAAAGTGTGAAAAATCCCGGCAATGGGCCAAGAGGATCAGG
AGCTATTAATTCGCGGAGGCAGCAAACACCCATCTGCCGAGCATCTGAACAATGTGAGTAGTACA
TGTGCATACATCTTAAGTTCACTTGATCTATAGGAACTGCGATTGCAACATCAAATTGTCTGCGG
CGTGAGAACTGCGACCCACAAAAATCCCAAACCGCAATCGCACAAACAAATAGTGACACGAAACA
GATTATTCTGGTAGCTGTGCTCGCTATATAAGACAATTTTTAAGATCATATCATGATCAAGACAT
CTAAAGGCATTCATTTTCGACTACATTCTTTTTTACAAAAAATATAACAACCAGATATTTTAAGC
TATGCACAAAAAATAAATAAAAGTATAAACCTACTTCGTAGGATACTTCGTTTTGTTCGGGGTTA
GATGAGCATAACGCTTGTAGTTGATATTTGAGATCCCCTATCATTGCAGGGTGACAGCGGACGCT
TCGCAGAGCTGCATTAACCAGGGCTTCGGGCAGGCCAAAAACTACGGCACGCTCCTGCCACCCAG
TCCGCCGGAGGACTCCGGTTCAGGGAGCGGCCAACTAGCCGAGAACCTCACCTATGCCTGGCACA
ATATGGACATCTTTGGGGcggtcaatcagccgggctccggatggcggcagctggtcaaccggaca
cgcggactattctgcaacgagcgacacataccggcgcccaggaaacatttgctcaagaacggtga
gtttctattcgcagtcggctgatctgtgtgaaatcttaataaagggtccaattaccaatttgaaa
ctcagTTTGCGGCGTGGCCTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCCGGTGCCGGAA
AGACGACCCTGCTGAATGCCCTTGCCTTTCGATCGCCGCAGGGCATCCAAGTATCGCCATCCGGG
ATGCGActgctcaatggccaacctgtggacgccaaggagatgcaggccaggtgcgcctatgtcca
gcaggatgacctctttatcggctccctaacggccagggaacacctgattttccaagccatggtgc
ggatgccacgacatctgacctatcggcagcgagtggcccgcgtggatcaggtgatccaggagctt
tcgctcagcaaatgtcagcacacgatcatcggtgtgcccggcagGGTGAAAGGTCTGTCCGGCGG
AGAAAGGAAGCGTCTGGCATTCGCCTCCGAGGCACTAACCGATCCGCCGCTTCTGATCTGCGATG
AGCCCACCTCCGGACTGGACTCATTTACCGCCCACAGCGTCGTCCAGGTGCTGAAGAAGCTGTCG
CAGAAGGGCAAGACCGTCATCCTGACCATTCATCAGCCGTCTTCCGAGCTGTTTGAGCTCTTTGA
CAAGATCCTTCTGATGGCCGAGGGCAGGGTAGCTTTCTTGGGCACTCCCAGCGAAGCCGTCGACT
TCTTTTCCTAGTGAGTTCGATGTGTTTATTAAGGGTATCTAGCATTACATTACATCTCAACTCCT
ATCCAGCGTGGGTGCCCAGTGTCCTACCAACTACAATCCGGCGGActtttacgtacaggtgttgg
ccgttgtgcccggacgggagatcgagtcccgtgatcggatcgccaagatatggcgacaattttgc
cattagcaaagtagcccgggatatggagcagttgttggccaccaaaaatctggagaagccactgg
agcagccggagaatgggtacacctacaaggccacctGGTTCATGCAGTTCCGGGCGGTCCTGTGG
CGATCCTGGCTGTCGGTGCTCAAGGAACCactcctcgtaaaagtgcgacttattcagacaacggt
gagtggttccagtggaaacaaatgatataacgcttacaattcttggaaacaaattcgctagattt
tagatagaattgcctgattccacacccttcttagtttttttcaatgagatgtatagtttatagtt
ttgcagaagataaataaatttcatttaactcgcgaatattaatgagatgcgagtaacattttaat
ttgcagatggttgccatcttgattggcctcatctttttgggccaacaactcacgcaagtgggtgt
gatgaatatcaacggagccatcttcctcttcctgaccaacatgacctttcaaaacgtctttgcca
cgataaatgtaagtcatgtttagaatacatttgcatttcaataatttactaactttctaatgaat
cgattcgatttaggtgttcacctcagagctgccagtttttatgagggaggcccgaagtcgacttt
atcgctgtgacacatactttctgggcaaaacgattgccgaattgccgctttttctcacagtgcca
ctggtcttcacggcgattgcctatccgatgatcggactgcgggccggagtgctgcacttcttcaa
ctgcctggcgctggtcactctggtggccaatgtgtcaacgtccttcggatatctaatatcctgcg
ccagctcctcgacctcgatggcgctgtctgtgggtccgccggttatcataccattcctgctcttt
ggcggcttcttcttgaactcgggctcggtgccagtatacctcaaatggttgtcgtacctctcatg
gttccgttacgccaacgagggtctgctgattaaccaatgggcggacgtggagccgggcgaaatta
gctgcacatcgtcgaacaccacgtgccccagttcgggcaaggtcatcctggagacgcttaacttc
tccgccgccgatctgccgctggactacgtgggtctggccattctcatcgtgagcttccgggtgct
cgcatatctggctctaagacttcgggcccgacgcaaggagtagccgacatatatccgaaataact
gcttgttttttttttttaccattattaccatcgtgtttactgtttattgccccctcaaaaagcta
atgtaattatatttgtgccaataaaaacaagatatgacctatagaatacaagtatttccccttcg
aacatccccacaagtagactttggatttgtcttctaaccaaaagacttacacacctgcatacctt
acatcaaaaactcgtttatcgctacataaaacaccgggatatattttttatatacatacttttca
aatcgcgcgccctcttcataattcacctccaccacaccacgtttcgtagttgctctttcgctgtc
tcccacccgctctccgcaacacattcaccttttgttcgacgaccttggagcgactgtcgttagtt
ccgcgcgattcggtTCGCTCAAATGGTTCCGAGTGGTTCATTTCGTCTCAATAGAAATTAGTAAT
AAATATTTGTATGTACAATTTATTTGCTCCAATATATTTGTATATATTTCCCTCACAGCTATATT
TATTCTAATTTAATATTATGACTTTTTAAGGTAATTTtttgtgacctgttcggagtgattagcgt
tacaatttgaactgaaagtgacatccagtgtttgttccttgtgtagatgcatctcaaaaaaatgg
tgggcataatagtgttgtttatatatatcaaaaataacaactataataataagaatacatttaat
ttagaaaatgcttggatttcactggaactagaattaattcggctgctgctctaaacgacgcattt
cgtactccaaagtacgaattttttCCCTCAAGCTCTTATTTTCATTAAACAATGAACAGGACCTA
ACGCACAGTCACGTTATTGTTTACATAAATGATTTTTTTTACTATTCAAACTTACTCTGTTTGTG
TACTCCCACTGGTATAGCCTTCTTTTATCTTTTCTGGTTCAGGCTCTATCACTTTACTAGGTACG
GCATCTGCGTTGAGTCGCCTCCTTTTAAATGTCTGACCTTTTGCAGGTGCAGCCTTCCACTGCGA
ATCATTAAAGTGGGTATCACAAATTTGGGAGTTTTCACCAAGGCTGCACCCAAGGCTCTGCTCCC
ACAATTTTCTCTTAATAGCACACTTCGGCACGTGAATTAATTTTACTCCAGTCACAGCTTTGCAG
CAAAATTTGCAATATTTCATTTTTTTTTATTCCACGTAAGGGTTAATGTTTTCAAAAAAAAATTC
GTCCGCACACAACCTTTCCTCTCAACAAGCAAACGTGCACTGAATTTAAGTGTATACTTCGGTAA
GCTTCGGCTTTCGACGGGACCACCTTATGTTATTTCATCATGGGCCAGACCCACGTAGTCCAGCG
GCAGATCGGCGGCGGAGAAGTTAAGCGTCTCCAGGATGACCTTGCCCGAACTGGGGCACGTGGTG
TTCGACGATGTGCAGCTAATTTCGCCCGGCTCCACGTCCGCCCATTGGTTAATCAGCAGACCCTC
GTTGGCGTAACGGAACCATGAGAGGTACGACAACCATTTGAGGTATACTGGCACCGAGCCCGAGT
TCAAGAAGAAGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAA
GCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG
CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCT
TGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCA
GAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGA
AGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTC
TTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGC
GCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAAC
GAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTT
AAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACC
AATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGA
CTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGAT
ACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCG
AGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCT
AGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGT
GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACAT
GATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAG
TTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATC
CGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGC
GACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAA
GTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATC
CAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT
CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGT
TGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAG
CGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAA
AAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATC
ACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCC
GGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAG
CGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTG
CACCATATGCGGTGTGAAATACCGCACCGAATCGCGCGGAACTAACGACAGTCGCTCCAAGGTCG
TCGAACAAAAGGTGAATGTGTTGCGGAGAGCGGGTGGGAGACAGCGAAAGAGCAACTACGAAACG
TGGTGTGGTGGAGGTGAATTATGAAGAGGGCGCGCGATTTGAAAAGTATGTATATAAAAAATATA
TCCCGGTGTTTTATGTAGCGATAAACGAGTTTTTGATGTAAGGTATGCAGGTGTGTAAGTCTTTT
GGTTAGAAGACAAATCCAAAGTCTACTTGTGGGGATGTTCGAAGGGGAAATACTTGTATTCTATA
GGTCATATCTTGTTTTTATTGGCACAAATATAATTACATTAGCTTTTTGAGGGGGCAATAAACAG
TAAACACGATGGTAATAATGGTAAAAAAAAAAACAAGCAGTTATTTCGGATATATGTCGGCTACT
CCTTGCGTCGGGCCCGAAGTCTTAGAGCCAGATATGCGAGCACCCGGAAGCTCACGATGAGAATG
GCCAGAC



More information about the Dros mailing list