DIN Vol. 19
KATHY MATTHEWS
MATTHEWK at UCS.INDIANA.EDU
Fri Jun 30 16:06:56 EST 1995
DROSOPHILA INFORMATION NEWSLETTER
Volume 19, July 1995
The Drosophila Information Newsletter is going away. The
network newsgroup bionet.drosophila is functioning well and can
carry out the functions of DIN with greater timeliness and less
effort. Volume 20 will be the final edition of DIN. Thank you
to all who contributed to DIN over the past five years.
We encourage readers of DIN to make use of the
bionet.drosophila newsgroup. You can participate in
bionet.drosophila via newsreader software on your local system,
by an e-mail subscription to bionet.drosophila, or through the
archive in FlyBase/News/bionet.drosophila. Message traffic on
bionet.drosophila averaged 2 messages per day from 1/1/95 through
6/28/95. Contact your local computer whiz if you want to access
bionet.drosophila with newsreader software. If you want an e-
mail subscription to bionet.drosophila, send a message to
biosci-server at net.bio.net with the following line in the body of
the message:
subscribe drosophila
The subject line can be blank. Send this message from the
account at which you wish to receive postings to
bionet.drosophila.
To post a message to the group, use your newsreader
software, or send your post as an e-mail message to
dros at net.bio.net. Unlike subscription messages, messages to be
posted must include a subject in the subject line of the message.
The editors:
Carl Thummel Kathy Matthews
Dept. of Human Genetics Dept. of Biology
Eccles Institute - Bldg. 533 Indiana University
University of Utah Bloomington, IN 47405
Salt Lake City, UT 84112 812-855-5782; FAX/2577
801-581-2937; FAX/5374 MATTHEWK at INDIANA.EDU
CTHUMMEL at HMBGMAIL.MED.UTAH.EDU MATTHEWK at INDIANA.BITNET
*** DIN 19
DIN Vol. 19 TABLE OF CONTENTS
>Drosophila Information Newsletter RIP
>How to use bionet.drosophila
>TABLE OF CONTENTS
>ANNOUNCEMENTS
>Crete 10th-Anniversary Meeting
>6th European Symposium on Drosophila Neurobiology
>Position available
>Stock center news
>MATERIALS AVAILABLE
>Library update - Tolias ovarian gt22A cDNA library
>REQUESTS FOR MATERIALS
>Genetic materials in 8A-C
>EQUIPMENT
>An inexpensive activity monitor suitable for Drosophila
*** DIN 19
ANNOUNCEMENTS
CRETE 10th-ANNIVERSARY MEETING
Spyros Artavanis-Tsakonas, Crete Workshop Organizing Committee,
Boyer Center for Molecular Medicine, Room 236, 295 Congress
Avenue, Yale University School of Medicine, New Haven, CT 06510
USA.
The Crete meeting on the Molecular and Developmental Biology
of Drosophila will be held from July 14th through July 20, 1996.
All subsequent meetings are also scheduled for the middle of
July. Although a formal announcement will be made in the Fall,
applications to attend the meeting are currently being accepted.
This will be the tenth anniversary of the Crete Workshop.
*** DIN 19
6TH EUROPEAN SYMPOSIUM ON DROSOPHILA NEUROBIOLOGY
Stephan Schneuwly
The next European Symposium on Drosophila Neurobiology will
be held on September 15-19, 1996 in Regensburg, Germany.
Regensburg is a beautiful historic bavarian city, which can be
easily reached by car, train and airplane (International Airports
of Munich and Frankfurt). To keep the meeting costs as low as
possible we are planning to communicate mainly through E-mail and
FlyBase. If you would like to be posted on the mailing list, send
a short message to the following mailbox:
sekretariat.schneuwly at biologie.uni-regensburg.de
*** DIN 19
POSITION AVAILABLE
An unusual job is open for applicants. Paul Johnston, Peter
Lawrence's assistant and collaborator of 20 years died in March.
Peter is now looking for someone to fill this post which is
funded by the Medical Research Council to be held in Cambridge,
England at the MRC Laboratory of Molecular Biology. The person
should be well experienced with flies (practical Drosophila
genetics, antibodies and RNA in situs, preparing eggs for
injection, dissecting and mounting adults, etc ). The work would
be to assist Peter in his own experiments and when he
collaborates with others. The style of the lab is old fashioned:
Peter works at the bench and the assistant would be, in the main,
a coauthor on the papers. The most important quality sought is
meticulousness and high standards. Salary would depend on paper
qualifications, such as whether the person has a PhD. A BA
degree or equivalent would be necessary. A work permit might be
obtainable for an ideally qualified person.
Interested? If so please email C.V. and relevant
information to Peter Lawrence at pal at mrc-lmb.cam.ac.uk or write
to him at the MRC Laboratory of Molecular Biology, Hills Rd.,
Cambridge, CB2 2QH, England.
*** DIN 19
STOCK CENTER NEWS - BLOOMINGTON
* We will be closed the week of September 17 (road trip!).
Requests received by 5:00 PM Wednesday, September 13 will be
shipped on Monday, September 18. Requests received between 5:00
PM on the 13th and 5:00 PM on Wednesday, September 27th will be
shipped on Monday, October 2. Mark your calendar.
* We have begun a collection of stocks carrying generally
useful GAL4 and UAS constructs. Stocks that are ready for
release are listed below with the names, pattern information, and
references provided by the donors. These short names will be
replaced by full genotypes when FlyBase curators have assigned
valid construct symbols and insertion identifiers. You may order
these now by stock number. We hope to have additional lines by
the end of the summer. If you have GAL4/UAS stocks of general
interest that you would like to contribute to the collection
please contact Kathy Matthews (matthewk at indiana.edu) or Thom
Kaufman (kaufman at bio.indiana.edu).
GAL4 constructs
1734 1J3 (hairy) [1,4,5]
1747 71B (imaginal discs) [1]
1767 24B/TM3 (embryonic mesoderm) [1]
1774 69B/TM3 (embryonic epiderm, imaginal discs) [1,4]
1782 32B/TM3 (imaginal discs) [1]
1795 30A/CyO (imaginal discs) [1,6]
1799 hs-Gal4[89-2-1]/TM3 (heat shock Gal4)
1803 55B (follicle cells) [3]
1822 31-1 (CNS/PNS)
1824 pGawB (basal expression)
1854 1-76-D (epidermal stripes)
1874 389 (embryonic CNS)
1878 T80 (ubiquitous in 3rd instar imaginal discs) [4]
1947 RG1 (paired) [1,5]
1967 34B [1,6]
1973 e22c (ubiquitous)
2017 ptc-Gal4 [8,4]
2023 hs-sev-Gal4 [9]
UAS constructs
1776 UAS-lacZ[4-1-2] (cytoplasmic beta-gal, insert on 2) [1]
1777 UAS-lacZ[4-2-4B]/TM3 (cytoplasmic beta-gal)
2025 D-Ras2[Val14] (constitutively activated Drosophila Ras2) [3]
2033 deltaD-Raf[F179] (constitutively activated Drosophila raf)
[3]
2074 deltaC-Raf1[ra2] (constitutively activated form of human Raf
1) [3]
2075 wg[tsM7-2-1] [4]
2076 en [5]
References
[1] Brand and Perrimon (1993) Development 118: 401-415
[2] Brand, Manoukian and Perrimon (1994) Methods in Cell Biology,
Vol 44: 635-654
[3] Brand and Perrimon (1994) Genes and Dev. 8: 629-639
[4] Wilder and Perrimon (1995) Development 121: 477-488
[5] Yoffee et al. (1995) Development, in press
[6] Ingham and Fietz (1995) Current Biology 5: 432-440
[7] Staehling-Hampton et al. (1994) Cell Growth and
Differentiation, in press
[8] Speicher et al. (1994) Development 120: 535-544
[9] Ruberte et al. (1995) Cell 80: 889-897
[10] Greig and Akam (1993) Nature 362: 630-632
[11] Hinz et al. (1994) Cell 76: 77-87
*** DIN 19
MATERIALS AVAILABLE
TOLIAS OVARIAN gt22A cDNA LIBRARY
Peter P. Tolias, Public Health Research Institute, 455 First
Ave., New York, NY 10016, USA. Phone: (212) 578-0815 office;
(212) 578-0816 lab; Fax: (212) 578-0804; E-mail:
tolias at phri.nyu.edu.
The following information updates that published in DIN Vol.
9 and DIS 72.
The available amplified aliquots of the Tolias ovarian
gt22A directional cDNA library were titred at 3 x 108 pfu/ml (99%
inserts) before freezing. The original complexity of this sample
was 500,000 independent clones (99.7% inserts). The 5' end has
unique sites for EcoRI and SalI (GAATTCGTCGACCCACGCGTCCG), the 3'
end has a unique NotI site. Use a fresh Y1090 O/N grown in LB amp
(50 ug/ml), 0.2% maltose and 10 mM MgSO4 as recommended by most
protocols. If you want to screen this library by PCR, I suggest
that you use a small fraction of this aliquot to reamplify and
use only reamplified samples for PCR.
This library has been widely distributed in the USA,
Canada and Europe. To conserve the remaining aliquots, please
check oogenesis labs in your area first before requesting it. If
it is not available, please send us a Federal Express number to
facilitate shipment. When you receive the library, divide it
into 50 ul aliquots in siliconized microfuge tubes, add one drop
of chloroform, store one of the aliquots at 4 deg C and freeze
the rest at -70 deg C. When a frozen aliquot is required, thaw,
use and store at 4 deg C but do not freeze again.
This library should be referenced in publications as:
"Stroumbakis, N.D., Li, Z. and Tolias, P.P. (1994). RNA- and
single-stranded DNA-binding (SSB) proteins expressed during
Drosophila melanogaster oogenesis: a homolog of bacterial and
eukaryotic mitochondrial SSBs. Gene 143, 171-177."
*** DIN 19
REQUESTS FOR MATERIALS
GENETIC MATERIALS IN 8A-C
Brenda Lilly, Baylor College of Medicine, One Baylor Plaza,
Houston, TX, 77030, USA. phone (713) 798-3569, FAX (713),
798-5386, lilly at bcm.tmc.edu.
I am looking for deficiencies, P-elements and chromosome
aberrations in the 8A-C region of the X-chromosome. Any
materials or information would be greatly appreciated. Thanks.
*** DIN 19
EQUIPMENT
AN INEXPENSIVE ACTIVITY MONITOR SUITABLE FOR DROSOPHILA
Robert Tyler and *Christopher Driver, Deakin University, Rusden
Campus, 662 Blackburn Rd Clayton 3168 AUSTRALIA.
*email; drierac at deakin.edu.au
INTRODUCTION
A commonly measured activity in Drosophila is locomotory
activity. It is reduced in a large number of mutants. In addition
one of us has used this measurement in investigating changes with
age ( Driver et alia 1986). The genetic dissection of this
activity offers an readily accessible window into the link
between activity and neurological function, particularly for an
activity which changes with age. We have been unable to find a
simple and inexpensive device to measure this and to simplify
further measurements we have built an electronic activity meter.
This meter responds to breaking an IR light beam and records each
break as a separate digit. A novel feature of our design is the
use of four calculators as four separate parallel recorders,
which enabled a substantial reduction in cost. The total cost of
components was under A$70. The device is portable and can be
placed in a controlled temperature cabinet so that activities can
be measured under controlled temperature and lighting conditions.
The use of batteries as power sources isolates the device from
power surges which might give false readings.
CONSTRUCTION
Circuit components were supplied by National Semiconductor.
IR beam. Four Photo-Interrupter pair (electronic catalog
listing ZD1901 or SY-508) were supplied with the emitter and
detector on the one block: these were cut into two at the base to
separate the emitter and detector. These were separately mounted
on either side of four holes on a particle board, which was
sufficiently large to fit four vial (25mm x 75 mm) snugly.
Recording devices: Citizen LC-510N electronic calculators.
Power pack: a battery pack which carries four AA batteries.
The use of rechargeable batteries has been found most convenient
because the drain on the batteries necessitates frequent changes.
Conditioning of the signal from the photo transistor was by
a Schmidt trigger flip flop (CD 4093) which converted
interruptions of currents to pulses. The input and out leads of
each of the four circuits on this chip were connected to the M+
key on the calculators. Inputs from the photo-interrupt were
connected to the terminals labelled CONT A,B,C, and D
respectively. The control voltage input was connected to the +
side of the power pack.
The - side of the battery pack was connected to a push
button switch and then via a 100 K ohm resistor to each
photo-interrupt.An indicator LED was also wired in, connecting
the side of the switch away from the battery to the + side of the
battery pack via a 470 ohm resistor.
The circuitry was then fixed to the same board that the
phot-interrupts were mounted on. Total dimensions: 450mm x80 mm
OPERATION
Vials containing 20 flies were used. The foam top was pushed
down into the tube to give a gap between the foam and the medium
of 150 mm. The tubes were inserted into the holes in the board.
The power from the batteries was switched on, the calculators
switched on and the number 1 entered into each calculator, in
that order. At the end of 5 minutes the <memory return> button
was pressed on each calculator to get an accumulated number. The
vials were changed to another hole and the readings repeated.
This procedure was repeated twice more so that each vial was
measured once in each hole. This alternation permits systematic
differences between recording sites to be evened out. In addition
the flies were restimulated to move. Between readings the
calculators were switched off, and the main power switched off,
in that order.
If there is no event for a long period the calculators will
turn off. This period is about five minutes, so if a calculator
was found to be turned off, the reading was taken as zero.
PROBLEMS IN OPERATION.
The device will measure activity in vials which have medium
in them, provided that the surfaces are clean. If the light beam
is blocked, difficulty will be experienced in operating the
calculators: the keys do not respond. In most cases this problem
could be overcome by repositioning the vials so that the IR beam
is not blocked.
It was also found that after prolonged operation the
calculator failed to respond to the keys, particularly during
the switching off procedure.This appears to be due to the drain
on the batteries. In addition, if the memory is not cleared
after the last use, then extra-ordinarily high readings may be
found after the next measurement. If the switching sequence above
is used so that the device has periods of being off between
readings, these problems can be minimised. However frequent
battery replacement (or recharging) is necessary.
RESULTS AND DISCUSSION.
An individual tube filled with Canton-S flies up to 7 days
old will give a reading of 50-200 counts at 20-25 degrees
celsius, although very inactive mutants such as dunce, and older
flies are considerably less active.
The activity measured is activity after alarm, i.e. an alarm
response. If flies are left undisturbed on a vibration free
surface for an hour or more, then counts measured over the next
20 minutes, without moving the vials, are in the order of 0-2. We
are using this to genetically dissect alarm response and the way
this changes with age. The results of this investigation will be
reported elsewhere.
REFERENCE
Driver, C.J.I.; Wallis, R.; Cosopodiotis, G.; Ettershank, G. Is a
Fat Metabolite the Major Diet Dependent Accelerator of Ageing?
Exp. Gerontol. 14:497-507; 1986.
*** DIN 19
More information about the Dros
mailing list