[bio.dros] [Drosophila] sequence of the pUAST vector

maki asano via dros%40net.bio.net (by asano At duke.edu)
Fri Dec 15 15:36:07 EST 2006


On 12/15/06 4:55 AM, "Christina Wagner" <cwagner At zoologie.uni-kiel.de>
wrote:

> Hallo,
> I would like to generate oligos for the sequences which I ligated
> into the pUAST vector. Does anybody have the vector sequence? The
> sequence of the vector enclosing the multiple cloning side is
> sufficient for the generation of the primers.
> Thank you very much in advance.
> Christina
> 
> _______________________________________________
> Dros mailing list
> Dros At net.bio.net
> http://www.bio.net/biomail/listinfo/dros


Dear Christina:  here it is. I tried to send you Stratagene file but got the
following message.  "Unfortunately, the bionet message system doesn't handle
attachments--only plain text messages.  If you'll paste the sequence
into the body of your e-mail, it will work."  so, if you'd like to have the
pUAST sequence as a file, you can send me an e-mail.  Maki

Maki Asano, M.D., Ph.D.
Assistant Research Professor
Department of Molecular Genetics and Microbiology
Duke University Medical Center

E-mail address: asano At duke.edu
Phone: 1-919-684-2392
Fax:  1-919-681-8984
http://mgm.duke.edu/faculty/asano/index.htm

address:

For FedeX:
Rm389 CARL Bldg
Dept. of MGM, DUMC
Research Dr. Durham,
NC27710, USA

For US mail:
POBox3654
Dept of MGM, DUMC
Research Dr. Durham,
NC27710, USA 




catgatgaaataacataaggtggtcccgtcgatagccgaagcttaccgaa
gtatacacttaaattcagtgcacgtttgcttgttgagaggaaaggttgtg
tgcggacgaatttttttttgaaaacattaacccttacgtggaataaaaaa
aaatgaaatattgcaaattttgctgcaaagctgtgactggagtaaaatta
attcacgtgccgaagtgtgctattaagagaaaattgtgggagcagagcct
tgggtgcagccttggtgaaaactcccaaatttgtgatacccactttaatg
attcgcagtggaaggctgcacctgcaaaaggtcagacatttaaaaggagg
cgactcaacgcagatgccgtacctagtaaagtgatagagcctgaaccaga
aaagataaaagaaggctataccagtgggagtacacaaacagagtaagttt
gaatagtaaaaaaaatcatttatgtaaacaataacgtgactgtgcgttag
gtcctgttcattgtttaatgaaaataagagcttgagggaaaaaattcgta
ctttggagtacgaaatgcgtcgtttagagcagcagccgaattaattctag
ttccagtgaaatccaagcattttctaaattaaatgtattcttattattat
agttgttatttttgatatatataaacaacactattatgcccaccattttt
ttgagatgcatctacacaaggaacaaacactggatgtcactttcagttca
aattgtaacgctaatcactccgaacaggtcacaaaaaattaccttaaaaa
gtcataatattaaattagaataaatatagctgtgagggaaatatatacaa
atatattggagcaaataaattgtacatacaaatatttattactaatttct
attgagacgaaatgaaccactcggaaccatttgagcgaaccgaatcgcgc
ggaactaacgacagtcgctccaaggtcgtcgaacaaaaggtgaatgtgtt
gcggagagcgggtgggagacagcgaaagagcaactacgaaacgtggtgtg
gtggaggtgaattatgaagagggcgcgcgatttgaaaagtatgtatataa
aaaatatatcccggtgttttatgtagcgataaacgagtttttgatgtaag
gtatgcaggtgtgtaagtcttttggttagaagacaaatccaaagtctact
tgtggggatgttcgaaggggaaatacttgtattctataggtcatatcttg
tttttattggcacaaatataattacattagctttttgagggggcaataaa
cagtaaacacgatggtaataatggtaaaaaaaaaaacaagcagttatttc
ggatatatgtcggctactccttgcgtcgggcccgaagtcttagagccaga
tatgcgagcacccggaagctcacgatgagaatggccagacccacgtagtc
cagcggcagatcggcggcggagaagttaagcgtctccaggatgaccttgc
ccgaactggggcacgtggtgttcgacgatgtgcagctaatttcgcccggc
tccacgtccgcccattggttaatcagcagaccctcgttggcgtaacggaa
ccatgagaggtacgacaaccatttgaggtatactggcaccgagcccgagt
tcaagaagaagccgccaaagagcaggaatggtatgataaccggcggaccc
acagacagcgccatcgaggtcgaggagctggcgcaggatattagatatcc
gaaggacgttgacacattggccaccagagtgaccagcgccaggcagttga
agaagtgcagcactccggcccgcagtccgatcatcggataggcaatcgcc
gtgaagaccagtggcactgtgagaaaaagcggtaattcggcaatcgtttt
gcccagaaagtatgtgtcacagcgataaagtcgacttcgggcctccctca
taaaaactggcagctctgaggtgaacacctaaatcgaatcgattcattag
aaagttagtaaattattaatatgcaaatgtattctaaacaagacttacat
ttatcgtggcaaagacgttttgaaaggtcatgttggtcaggaagaggaag
atggctccgttgatattcatcacgcccacttgcgtgagttgttggcccaa
aaagatgaggccaatcaagatggcaaccatctgcaaattaaaatgttact
cgcatctcattaatattcatatcttcaacatgttcgcgagttaaatgaaa
tttatttattttctgcaaaactataaactatacatctcattgaaaaaaac
taagaagggtgtggaatcaggcaattctaactaaaatctagcgaatttgt
ttccaagaattgtaagcgttatatcatttgtttccactggaaccactcac
cgttgtctgaataagtcgcacttttacgaggagtggttccttgagcaccg
acagccaggatcgccacaggaccgcccggaactgcatgaaccaggtggcc
ttgtaggtgtacccattctccggctgctccagtggcttctccaaattttt
ggtggccaacaactgctccatatcccgggctactttgctaatagcaaaat
tgtcgcatatcttggcgatccgatcacgggactcgatctcccgtccgggc
acaacggccaacacctgtacgtaaaagtccgccggattgtagttggtagg
acactgggcacccacgctggataggagttgagatgtaatgtaatgctaga
tacccttaataaacacatcgaactcactaggaaaagaagtcgacggcttc
gctgggagtgcccaagaaagctaccctgccctcggccatcagaaggatct
tgtcaaagagctcaaacagctcggaagacggctgatgaatggtcaggatg
acggtcttgcccttctgcgacagcttcttcagcacctggacgacgctgtg
ggcggtaaatgagtccagtccggaggtgggctcatcgcagatcagaagcg
gcggatcggttagtgcctcggaggcgaatgccagacgcttcctttctccg
ccggacagacctttcaccctgccgggcacaccgatgatcgtgtgctgaca
tttgctgagcgaaagctcctggatcacctgatccacgcgggccactcgct
gccgataggtcagatgtcgtggcatccgcaccatggcctggaaaatcagg
tgttccctggccgttagggagccgataaagaggtcatcctgctggacata
ggcgcacctggcctgcatctccttggcgtccacaggttggccattgagca
gtcgcatcccggatggcgatacttggatgccctgcggcgatcgaaaggca
agggcattcagcagggtcgtctttccggcaccggaactgcccatcacggc
caaaagttcgcccggataggccacgccgcaaactgagtttcaaattggta
attggaccctttattaagatttcacacagatcagccgactgcgaatagaa
actcaccgttcttgagcaaatgtttcctgggcgccggtatgtgtcgctcg
ttgcagaatagtccgcgtgtccggttgaccagctgccgccatccggagcc
cggctgattgaccgccccaaagatgtccatattgtgccaggcataggtga
ggttctcggctagttggccgctccctgaaccggagtcctccggcggactg
ggtggcaggagcgtgccgtagtttttggcctgcccgaagccctggttaat
gcagctctgcgaagccgctccgctgtcaccctgcaatgataggggatctc
aaatatcaactacaagcgttatgctcatctaaccccgaacaaaacgaagt
atcctacgaagtaggtttatacttttatttattttttgtgcatctaggat
cagcttaaaatatctggttgttatattttttgtaaaaaagaatgtagtcg
aaaatgaatgcctttagatgtcttgatcatgatatgatcttaaaaattgt
cttatatagcgagcacagctaccagaataatctgtttcgtgtcactattt
gtttgtgcgattgcggtttgggatttttgtgggtcgcagttctcacgccg
cagacaatttgatgttgcaatcgcagttcctatagatcaagtgaacttaa
gatgtatgcacatgtactactcacattgttcagatgctcggcagatgggt
gtttgctgcctccgcgaattaatagctcctgatcctcttggcccattgcc
gggatttttcacactttcccctgcttacccacccaaaaccaatcaccacc
ccaatcactcaaaaaacaaacaaaaataagaagcgagaggagttttggca
cagcactttgtgtttaattgatggcgtaaaccgcttggagcttcgtcacg
aaaccgctgacaaagtgcaactgaaggcggacattgacgctaggtaacgc
tacaaacggtggcgaaagagatagcggacgcagcggcgaaagagacggcg
atatttctgtggacagagaaggaggcaaacagcgctgactttgagtggaa
tgtcattttgagtgagaggtaatcgaaagaacctggtacttcaaataccc
ttggatcgaagtaaatttaaaactgatcagataagttcaatgatgtccag
tgcagtaaaaaataaaaaaaaaatatgtttttttaaatctacattctcca
aaaaagggttttattaacttacatacatactaaggccttctagtggatcc
gatccagacatgataagatacattgatgagtttggacaaaccacaactag
aatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctt
tatttgtaaccattataagctgcaataaacaagttaacaacaacaattgc
attcattttatgtttcaggttcagggggaggtgtgggaggttttttaaag
caagtaaaacctctacaaatgtggtatggctgattatgatctctagtcaa
ggcactatacatcaaatattccttattaacccctttacaaattaaaaagc
taaaggtacacaatttttgagcatagttattaatagcagacactctatgc
ctgtgtggagtaagaaaaaacagtatgttatgattataactgttatgcct
acttataaaggttacagaatatttttccataattttcttgtatagcagtg
cagctttttcctttgtggtgtaaatagcaaagcaagcaagagttctatta
ctaaacacagcatgactcaaaaaacttagcaattctgaaggaaagtcctt
ggggtcttctacctttctcttcttttttggaggagtagaatgttgagagt
cagcagtagcctcatcatcactagatggcatttcttctgagcaaaacagg
ttttcctcattaaaggcattccaccactgctcccattcatcagttccata
ggttggaatctaaaatacacaaacaattagaatcagtagtttaacacatt
atacacttaaaaattttatatttaccttagagctttaaatctctgtaggt
agtttgtccaattatgtcacaccacagaagtaaggttccttcacaaagat
cctctagaggtaccctcgagccgcggccgcagatctgttaacgaattccc
aattccctattcagagttctcttcttgtattcaataattacttcttggca
gatttcagtagttgcagttgatttacttggttgctggttacttttaattg
attcactttaacttgcactttactgcagattgtttagcttgttcagctgc
gcttgtttatttgcttagctttcgcttagcgacgtgttcactttgcttgt
ttgaattgaattgtcgctccgtagacgaagcgcctctatttatactccgg
cgctcgctagagtctccgctcggaggacagtactccgctcggaggacagt
actccgctcggaggacagtactccgctcggaggacagtactccgctcgga
ggacagtactccgacctgcaggcatgcaagcttggatccgagctcatgca
gaagctttgcgtactcgcaaattattaaaaataaaactttaaaaataatt
tcgtctaattaatattatgagttaattcaaaccccacggacatgctaagg
gttaatcaacaatcatatcgctgtctcactcagactcaatacgacactca
gaatactattcctttcactcgcacttattgcaagcatacgttaagtggat
gtctcttgccgacgggaccaccttatgttatttcatcatggtctggccat
tctcatcgtgagcttccgggtgctcgcatatctggctctaagacttcggg
cccgacgcaaggagtagccgacatatatccgaaataactgcttgtttttt
tttttaccattattaccatcgtgtttactgtttattgccccctcaaaaag
ctaatgtaattatatttgtgccaataaaaacaagatatgacctatagaat
acaagtatttccccttcgaacatccccacaagtagactttggatttgtct
tctaaccaaaagacttacacacctgcataccttacatcaaaaactcgttt
atcgctacataaaacaccgggatatattttttatatacatacttttcaaa
tcgcgcgccctcttcataattcacctccaccacaccacgtttcgtagttg
ctctttcgctgtctcccacccgctctccgcaacacattcaccttttgttc
gacgaccttggagcgactgtcgttagttccgcgcgattcggtgcggtatt
tcacaccgcatatggtgcactctcagtacaatctgctctgatgccgcata
gttaagccagccccgacacccgccaacacccgctgacgcgccctgacggg
cttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccggg
agctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacg
aaagggcctcgtgatacgcctatttttataggttaatgtcatgataataa
tggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacc
cctatttgtttatttttctaaatacattcaaatatgtatccgctcatgag
acaataaccctgataaatgcttcaataatattgaaaaaggaagagtatga
gtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgc
cttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctga
agatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcg
gtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagc
acttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgg
gcaagagcaactcggtcgccgcatacactattctcagaatgacttggttg
agtactcaccagtcacagaaaagcatcttacggatggcatgacagtaaga
gaattatgcagtgctgccataaccatgagtgataacactgcggccaactt
acttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcaca
acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaat
gaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggc
aacaacgttgcgcaaactattaactggcgaactacttactctagcttccc
ggcaacaattaatagactggatggaggcggataaagttgcaggaccactt
ctgcgctcggcccttccggctggctggtttattgctgataaatctggagc
cggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggta
agccctcccgtatcgtagttatctacacgacggggagtcaggcaactatg
gatgaacgaaatagacagatcgctgagataggtgcctcactgattaagca
ttggtaactgtcagaccaagtttactcatatatactttagattgatttaa
aacttcatttttaatttaaaaggatctaggtgaagatcctttttgataat
ctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcaga
ccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcg
taatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgt
ttgccggatcaagagctaccaactctttttccgaaggtaactggcttcag
cagagcgcagataccaaatactgtccttctagtgtagccgtagttaggcc
accacttcaagaactctgtagcaccgcctacatacctcgctctgctaatc
ctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggtt
ggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacgg
ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactg
agatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggag
aaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgca
cgagggagcttccagggggaaacgcctggtatctttatagtcctgtcggg
tttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggg
gcggagcctatggaaaaacgccttcttcttgaactcgggctcggtgccag
tatacctcaaatggttgtcgtacctctcatggttccgttacgccaacgag
ggtctgctgattaaccaatgggcggacgtggagccgggcgaaattagctg
cacatcgtcgaacaccacgtgccccagttcgggcaaggtcatcctggaga
cgcttaacttctccgccgccgatctgccgctggactacgtgggtctggcc



More information about the Dros mailing list