genome data base

[Chris Porter]

In article <199512061458.JAA126860 at r02n07.cac.psu.edu>, cth3 at EMAIL.PSU.EDU
(Thomas Hwang) wrote:

> Dear netters
> I need someone's help how can I connect to genome data base to find the
> sequence of microsatellite. 
> Otherwise, does somebody know D11S988's sequence.
> If you help me, you will be very appreciated.
> Thanks
> 


Dear Thomas,

You can search GDB on the World Wide Web, using any web browser which
supports forms (Netscape, Mosaic v2, Lynx etc.). The address of the GDB
home page is:

http://gdbwww.gdb.org/

In order to find PCR primers for D11S988, the simplest method is to click on the
"Finding Genes in GDB" link. On the next screen select "Reagents for gene
analysis", which will bring up a simple search form. Enter the locus
symbol (D11S988) in the "Gene name" field, make sure that "PCR primers" is
selected,
and click on "Submit query". This will return a table containing one row
(the one set of PCR primers available for D11S988). Click on the
underlined GDB ID on the right to retrieve more information, including
primer sequences and reaction conditions.

The primer sequences for D11S988 are:
----------------------------------------------------------------------------
Primer Name: 1020                                   Length: 21  Orien: 5'-3'
     Sequence: GGGACAAGAGAAAGTTGAACA
Primer Name: 1019                                   Length: 22  Orien: 5'-3'
     Sequence: CAGAAAATAGTTCAGACCACCA
Amplified Product Size:    0.112 -    0.138  kb
----------------------------------------------------------------------------

If you need the full sequence of the microsatellite repeat, that
information is not stored in GDB. We do store links to the sequence
databases, but there are none in GDB for D11S988. This may indicate that
the full sequence has not been submitted to the sequence databases.

If you don't have access to the World Wide Web, GDB can also be searched
by email. Send email to mailserv at gdb.org with the word "help" (without
quotes) in the body of the message. Instructions on how to search with
email will be returned to you.

If you have further questions you can send email to help at gdb.org or post
messages on bionet (there is also a GDB newsgroup - bionet.molbio.gdb). I
hope that this will help you with further searches.

Sincerely,

Chris Porter

______________________________________________________________________________
Christopher J Porter                                  Phone: +1 (410) 614-1851 
Data Acquisition and Curation                           Fax: +1 (410) 614-0434
Genome Data Base                                        Email: cporter at gdb.org

        *** The GDB Browser on the WWW *** http://gdbwww.gdb.org/ ***