Neisseria meningitidis updated

Tatiana Tatusov tatiana at
Wed Apr 5 19:36:16 EST 2000

The annotation of the Neisseria meningitidis genome has been updated
by TIGR. The corresponding records have been updated in GenBank.

Complete geneome sequence text file can be found on NCBI ftp site

Tatiana Tatusova
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
Voice: (301)435-5756
Fax: (301)480-9241
email tatiana at


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list