IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

GbUpdate Problem : nc0201 : Invalid Version/GI Values

Mark Cavanaugh cavanaug at lagrange.nlm.nih.gov
Tue Feb 1 21:39:17 EST 2000

Greetings GenBank Users,

The nc0201 GenBank Update files contained nine records with
incorrect sequence version and/or GI values. Here are the
VERSION lines of the affected records from the flatfile version
of the update:

VERSION     AC008143.3  GI:7
VERSION     AC008139.1  GI:7
VERSION     AC008097.1  GI:7
VERSION     AC008260.1  GI:7
VERSION     AC011071.1  GI:-277407540
VERSION     AC008208.1  GI:-277407540
VERSION     AC008204.1  GI:-277407540
VERSION     AC008192.1  GI:-277407540
VERSION     AC007522.1  GI:-277407540

Patched nc0201 GbUpdate files in which these nine records have
been removed were installed on our FTP server at 9:16pm EST on
Tuesday, February 1:


If the records successfully loaded into your system in spite of
the invalid GI values and the version number regression (eg, the
previous version number for AC011071 was 7), then we suggest
that you simply wait for the next incremental GbUpdate. These nine
records will be included, with corrected version numbers and GIs.

If all goes well, that GbUpdate (nc0202) should be available
on Wednesday, February 2, between 2:00am and 3:00am EST.

Due to their sizes, we did not patch the cumulative GbUpdate
files. However, the nine problem records will be fixed there as
well after the next CU rebuild completes (nominally 10:00am
tomorrow morning).

This problem arose due to poor error-handling that was triggered
when server timeouts occurred between two component databases of
our system. Our apologies for any inconvenience that it has caused,
and our thanks to colleagues at the EBI for reporting the invalid
version/GI values.

Mark Cavanaugh

- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  

More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net