IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Campylobacter jejuni complete genome

Tatiana Tatusov tatiana at azalea.nlm.nih.gov
Tue Feb 15 21:31:21 EST 2000

Sanger has submitted the complete sequence of Campylobacter 
jejuni to EMBL.

The complete genome has been split into 6 segments with 
primary accession numbers AL139074-9, and secondary accession number
(complete genome) AL111168. 

The files are available from 


Sequence files are also available form NCBI ftp site:


Graphical presentation will appear in Entrez Genomes



Tatiana Tatusova
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
email tatiana at ncbi.nlm.nih.gov


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  

More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net