Campylobacter jejuni complete genome

Tatiana Tatusov tatiana at
Tue Feb 15 21:31:21 EST 2000

Sanger has submitted the complete sequence of Campylobacter 
jejuni to EMBL.

The complete genome has been split into 6 segments with 
primary accession numbers AL139074-9, and secondary accession number
(complete genome) AL111168. 

The files are available from

Sequence files are also available form NCBI ftp site:

Graphical presentation will appear in Entrez Genomes

Tatiana Tatusova
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
email tatiana at


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list