Course in informatics for Biology 2001
Laurent Bloch
bloch at pasteur.fr
Fri Jun 9 09:30:27 EST 2000
Course in informatics offered at the Pasteur Institute.
======================================================
In the series of courses offered at the Pasteur Institute, a course
will be offered in informatics in biology. The next session will take
place from the 3th of January to the 6th of April 2001. The course
description is attached.
----------------------------------------------------------------------
| |
| The courses at Pasteur Institute are |
| organized with the collaboration of the two largest Parisian |
| scientific universities, Paris VI "Pierre et Marie Curie" and |
| Paris VII "Denis Diderot". The diplomas delivered to students |
| of these courses are considered as university degrees. |
| |
----------------------------------------------------------------------
Registration is mandatory via the committee of courses. Call the
secretary of Information and Education of the Pasteur Institute at
+33 1 45 68 81 40 or via E-mail at algo at pasteur.fr for further
information. See also:
http://www.pasteur.fr/formation/infobio-en.html
http://www.pasteur.fr/units/sis/B6/10/10.html#8
The working language of the course is French. Tuition costs: a
nominal fee, approximately 3 000 French Francs (500 US Dollars).
Course Description
==================
Informatics in biology
----------------------
The objective of this course is to give to the researchers and future
researchers in biology, an initial exposure to informatics. Entry in
the course is reserved to those with a degree in biology or a related
discipline.
With more and more tools available to the biologist, it has become important
that the biologist acquire the ability to judge for themselves the
usefulness of a new software by the algorithms it employs.
The accent is put on the fundamental aspect of this discipline. Two
applications in biology will be studied, the analysis of sequences
and molecular modeling.
The theoretic aspects of informatics will be introduced: programming
languages, programing, logic, and also in the technical domain of
the system, the network, and computer architecture. Programming is taught
according to the functional paradigm (Lisp), but other styles
of programming, such as algorithmic and object oriented, will be introduced.
The goal of an excellent level of theory will not hurt the acquisition of
practical knowledge which will be directly usable in the labratory.
The course will consist of lectures and practical sessions.
Algorithms, programming practice and theory (course) 60h
Algorithms and programming practical (with Scheme) 42h
Programming with Java 18h
Programming with Java practical 21h
Computing systems: evolution and realizations 12h
Introduction to Unix and X practical 17h
Perspectives of informatics lecture 10h
Algorithms for Biology
Algorithms 36h
Examples (Sequence analysis) practical 36h
Molecular modelling 15h
Software installation (blast) 10h
Data Bases 12h
Machine architecture and System planning 15h
Logic 10h
Networks 12h
====================================================================
Total 326h
Course Instructors
Laurent Bloch
William Saurin
Manuel Serrano
Christian Queinnec
Érick Gallesio
Marie-France Sagot
Daniel Azuelos
Eric Gressier
Thierry Rose
Louis Jones
Bernard Caudron
Marc Baudoin
Stephane Bortzmeyer
Katja Schuerer
Éric Deveaud
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
More information about the Genbankb
mailing list