Chlamydia complete genomes

Tatiana Tatusov tatiana at
Wed Mar 8 16:21:40 EST 2000

Complete genomes of Chlamydia muridarum (Chlamydia trachomatis MoPn) and 
Chlamydophila pneumoniae AR39 (synonym: Chlamydia pneumoniae AR39)
have been published.

  AUTHORS   Read,T.D., Brunham,R.C., Shen,C., Gill,S.R., Heidelberg,J.F.,
            White,O., Hickey,E.K., Peterson,J., Utterback,T., Berry,K.,
            Bass,S., Linher,K., Weidman,J., Khouri,H., Craven,B., Bowman,C.,
            Dodson,R., Gwinn,M., Nelson,W., DeBoy,R., Kolonay,J., McClarty,G.,
            Salzberg,S.L., Eisen,J. and Fraser,C.M.
  TITLE     Genome sequences of Chlamydia trachomatis MoPn and C. pneumoniae
  JOURNAL   Nucleic Acids Res. 28, 1397-1406 (2000)

Sequence data can be found at NCBI ftp site:

Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
Voice: (301)435-5756
Fax: (301)480-9241
email tatiana at


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list