Chlamydia complete genomes

Tatiana Tatusov tatiana at azalea.nlm.nih.gov
Wed Mar 8 16:21:40 EST 2000


Complete genomes of Chlamydia muridarum (Chlamydia trachomatis MoPn) and 
Chlamydophila pneumoniae AR39 (synonym: Chlamydia pneumoniae AR39)
have been published.

  AUTHORS   Read,T.D., Brunham,R.C., Shen,C., Gill,S.R., Heidelberg,J.F.,
            White,O., Hickey,E.K., Peterson,J., Utterback,T., Berry,K.,
            Bass,S., Linher,K., Weidman,J., Khouri,H., Craven,B., Bowman,C.,
            Dodson,R., Gwinn,M., Nelson,W., DeBoy,R., Kolonay,J., McClarty,G.,
            Salzberg,S.L., Eisen,J. and Fraser,C.M.
  TITLE     Genome sequences of Chlamydia trachomatis MoPn and C. pneumoniae
            AR39
  JOURNAL   Nucleic Acids Res. 28, 1397-1406 (2000)


Sequence data can be found at NCBI ftp site:

ftp://ncbi.nlm.nih.gov/genbank/genomes/bacteria/CtraM/
ftp://ncbi.nlm.nih.gov/genbank/genomes/bacteria/CpneuA


---------------------
Tatiana Tatusova, PhD
National Center for Biotechnology Information
National Library of Medicine
National Institutes of Health
Bethesda, MD 20894, USA
Voice: (301)435-5756
Fax: (301)480-9241
email tatiana at ncbi.nlm.nih.gov



---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  







More information about the Genbankb mailing list