GenBank Release 117.0 Available

Mark Cavanaugh cavanaug at lagrange.nlm.nih.gov
Wed May 3 05:40:40 EST 2000


Greetings GenBank Users,

  GenBank Release 117.0 is now available via ftp from the National Center
for Biotechnology Information:

  Ftp Site           Directory   Contents
  ----------------   ---------   ---------------------------------------
  ncbi.nlm.nih.gov   genbank     GenBank Release 117.0 flatfiles
                     ncbi-asn1   ASN.1 data used to create Release 117.0

  Uncompressed, the Release 117.0 flatfiles require roughly 24684 MB
(sequence files only) or 29031 MB (including the 'index' files). The
ASN.1 version requires roughly 20487 MB. From the release notes:

   Release  Date       Base Pairs   Entries

   116      Feb 2000   5805414935   5691170
   117      Apr 2000   7376080723   6215002

  In the nine-week period between close-of-data for GenBank 116.0 and
GenBank 117.0, GenBank grew by a record 1.570 billion basepairs.

  Close-of-data was 04/25/2000. Eight days were required to prepare this
release. Like Release 116.0, 117.0 has been delayed by two weeks, this time
due to changes in the systems used to generate the GenBank flatfiles that
comprise releases. These changes should be complete by June, so we expect
no delays for 118.0 . The release date for 117.0 remains "April 15",
chiefly as a convenience for recording growth stats.

 PLEASE NOTE: Problems were encountered once again building the author-name
index file (gbaut.idx) for GenBank 117.0 . The version now available on
our ftp site, while complete (and exceeding 3.6 GB in size), has not been
converted to the tabular format required for this file. Rather than delay
GenBank 117.0 even further, we are making the index available in its raw form.
If resources permit, we will convert gbaut.idx to its proper format; our
apologies for any inconvenience that this causes.

 (See also Section 1.4.2 of the release notes, below)

 For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 117.0 and Upcoming Changes) have been appended below.

  Release 117.0 data are currently available via NCBI's Entrez and Blast
servers, and the 'query' email server.

  New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 117.0 close-of-data, should be
available by 6:00am EDT, May 3. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 116.0 was
posted.

  If you encounter problems while ftp'ing or uncompressing Release 117.0,
please send email outlining your difficulties to info at ncbi.nlm.nih.gov .

Mark Cavanaugh
GenBank
NCBI/NLM/NIH


1.3 Important Changes in Release 117.0

1.3.1 Organizational changes

  Due to database growth, the EST division is now being split into fifty-five
pieces.

  Due to database growth, the GSS division is now being split into nineteen
pieces.

  Due to database growth, the HTG division is now being split into thirty-one
pieces.

  Due to database growth, the INV division is now being split into three pieces.

  Due to database growth, the VRL division is now being split into two pieces.

1.3.2 Mutation and Allele features discontinued

  Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that the functionality provided by the variation, mutation, and
allele features can be represented by just a single feature, variation.
With GenBank Release 117.0, all existing mutation and allele features 
have been converted to variation; mutation and allele are no longer legal
feature keys.

Reminder: complete Feature Table documentation is available at this URL:

	http://www.ncbi.nlm.nih.gov/collab/FT/index.html

1.4 Upcoming Changes

1.4.1 New PUBMED linetype for REFERENCEs

  Starting with GenBank Release 119.0 in August 2000, a new PUBMED
linetype will be legal for the REFERENCE block of GenBank flatfiles:

LOCUS       AF245949      558 bp    RNA             VRL       30-APR-2000
DEFINITION  Hepatitis C virus isolate P11 clone A41 polyprotein precursor,
            E1/E2 region, gene, partial cds.
ACCESSION   AF245949
VERSION     AF245949.1  GI:7670856
....
REFERENCE   1  (bases 1 to 558)
  AUTHORS   Farci,P., Shimoda,A., Coiana,A., Diaz,G., Peddis,G.,
            Melpolder,J.C., Strazzera,A., Chien,D.Y., Munoz,S.J.,
            Balestrieri,A., Purcell,R.H. and Alter,H.J.
  TITLE     The outcome of acute hepatitis C predicted by the evolution of the
            viral quasispecies
  JOURNAL   Science 288 (5464), 339-344 (2000)
  MEDLINE   20230065
   PUBMED   10764648

  The PUBMED identifier is the record identifier for article abstracts
in the PubMed database :

       http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed

  Abstracts in PubMed that do not fall within Medline's scope will have only
a PUBMED identifier. Similarly, abstracts that *are* in Medline's scope but
which have not yet been assigned Medline UIs will have only a PUBMED identifier.
If an abstract is present in both the PubMed and Medline databases, both Medline UI
and PubMed ID will be provided.

1.4.2 New format for GenBank Index files

  Starting with GenBank Release 119.0 in August 2000, the format of the
"index" files for releases will change from a tabular, fixed-column
format to a TAB-delimited, line-oriented format. The header information
at the start of index files will no longer be provided.

  In general, index file entries consist of a line containing the indexed
term, followed by a table containing LOCUS/DIVISION/ACCESSION triplets.
For example:

GBKEY.IDX          Genetic Sequence Data Bank
                         15 April 2000

               NCBI-GenBank Flat File Release 117.0

                       Keyword Phrase Index

 6215002 loci,  7376080723 bases, from 6215002 reported sequences
....
ZONA PELLUCIDA 2 GLYCOPROTEIN
             AB000929   ROD AB000929 CATFZP2G   MAM D45067 CJZPG2     PRI Y10767
             DOGCZP2G   MAM D45069 MRZPG2     PRI Y10690 PIGPZP2G   MAM D45064

  Notice that the "fixed" format is already broken, due to the presence of
eight-character accession numbers. Rather than define a new fixed format
that will break at some point in the future, and at the expense of slightly
larger files, the new index files for the above example will look like so:

ZONA PELLUCIDA 2 GLYCOPROTEIN
	   AB000929   ROD AB000929
	   CATFZP2G   MAM D45067
	   CJZPG2     PRI Y10767
	   DOGCZP2G   MAM D45069
	   MRZPG2     PRI Y10690
	   PIGPZP2G   MAM D45064

A series of LOCUS/DIVISION/ACCESSION triplets, TAB-delimited (and with
a leading TAB), one per line, will follow each indexed value.

  Complete details about the changes to the index files will be provided
via the GenBank newsgroup (bionet.molbio.genbank) and future release notes.

1.4.3 STS division will be split into multiple files

  The STS GenBank division (gbsts.seq) will soon be split into multiple
files, since its size exceeds 300MB. This is likely to occur by GenBank
Release 118.0 (June 2000). The resulting files for STS will be:
gbsts1.seq and gbsts2.seq .

1.4.4 File-naming convention for ASN.1 data files will be changed.

  Starting with GenBank Release 119.0 in August 2000, the filename
convention for the ASN.1 data files used to create GenBank flatfile
releases will be changed. These ASN.1 files can be found at the NCBI
ftp site:

    ftp://ncbi.nlm.nih.gov/ncbi-asn1/

The naming convention for these files is currently:

    DIV-CODE.aso.Z

For example:

    bct1.aso.Z
    bct2.aso.Z

  This convention will be changed so that the ASN.1 filenames and the
GenBank flatfile names match more closely:

    gbDIV-CODE.aso.Z

For example:

    gbbct1.aso.Z
    gbbct2.aso.Z

1.4.5 Selenocysteine representation

  Selenocysteine residues within the protein translations of coding
region features have been represented in GenBank via the letter 'X'
and a /transl_except qualifier. At the May 1999 DDBJ/EMBL/GenBank
collaborative meeting, it was learned that IUPAC plans to adopt the
letter 'U' for selenocysteine.

  DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation
for its /translation qualifiers. Although a timetable for its appearance
has not been finalized, we are mentioning this now because the introduction
of a new residue abbreviation is a fairly fundamental change.

  Details about the use of 'U' will be made available via these release
notes and the GenBank newsgroup as they become available.

1.4.6 New REFERENCE type for on-line journals

  Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that an effort should be made to accomodate references which are
published only on-line. Until specifications for such references are
available from library organizations, GenBank will present them in a manner
like this:

	REFERENCE   1  (bases 1 to 2858)
	  AUTHORS   Smith, J.
	  TITLE     Cloning and expression of a phospholipase gene
	  JOURNAL   Online Publication
	  REMARK    Online-Journal-name; Article Identifier; URL

  This format is still tentative; additional information about this new
reference type will be made available via these release notes.
---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  







More information about the Genbankb mailing list