GenBank LOCUS bugs GCG 2BIT token

Lynn Miller miller at
Mon May 29 09:50:43 EST 2000


A recent entry, CNS02BIT, in the EMBL and GenBank public databases 
revealed a problem with the GCG program DBIndex.  This program
is called by all of the GCG database formatting programs, including

Though the entry appeared to format without error, in many
when you attempted to access that sequence with other GCG programs, the 
following error message was reported:

  *** ERROR in SQNext. Sequence reading is out of synch.

A solution for this problem can be obtained by contacting 
the GCG Bioinformatics Support team at the address
mailto:help at

Lynn Miller, Bioinformatics Support Manager
 Genetics Computer Group, An Oxford Molecular Company
 575 Science Drive, Madison, WI USA 53711
 phone: (608)231-5200  
 GCG:         help at
 Oxford Mol:  support at


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list