IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

GbUpdate : Problem for Recent Qscore and FASTA Files

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Fri Oct 13 15:26:57 EST 2000


Greetings GenBank Users,

A software problem resulted in no Quality Score files being
generated for incremental GenBank Updates between the dates
of 09/30/2000 and 10/13/2000 .

This problem also affected the protein FASTA files generated
during that time period: they contained *only* the protein
translations for sequences provided by the US centers generating
HTG (high throughput genomic sequence) data for the Human Genome
Project.

A complete list of the files affected is appended below. They
were rebuilt and reinstalled on NCBI's FTP site on Friday,
October 13 at approximately 4:00pm EDT.

If you obtained any of the affected ncMMDD.qscore.gz or
ncMMDD.fsa.gz files in the past two weeks, you should re-transfer
and re-process them.

The GenBank flatfiles (ncMMDD.flat.gz) and ASN.1 files
(ncMMDD.aso.gz) were not affected by this problem.

We apologize for any inconvenience that this dataflow error
might have caused.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH

=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=

Qscore and FASTA files patched

URL: ftp://ncbi.nlm.nih.gov/genbank/daily-nc/

File list:

nc0930.fsa.gz
nc0930.qscore.gz
nc1001.fsa.gz
nc1001.qscore.gz
nc1002.fsa.gz
nc1002.qscore.gz
nc1003.fsa.gz
nc1003.qscore.gz
nc1004.fsa.gz
nc1004.qscore.gz
nc1005.fsa.gz
nc1005.qscore.gz
nc1006.fsa.gz
nc1006.qscore.gz
nc1007.fsa.gz
nc1007.qscore.gz
nc1008.fsa.gz
nc1008.qscore.gz
nc1009.fsa.gz
nc1009.qscore.gz
nc1010.fsa.gz
nc1010.qscore.gz
nc1011.fsa.gz
nc1011.qscore.gz
nc1012.fsa.gz
nc1012.qscore.gz
nc1013.fsa.gz
nc1013.qscore.gz


---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  








More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net