GenBank Release 120.0 Available

Mark Cavanaugh cavanaug at
Wed Oct 18 23:52:55 EST 2000

Greetings GenBank Users,

  GenBank Release 120.0 is now available via ftp from the National Center
for Biotechnology Information:

  Ftp Site           Directory   Contents
  ----------------   ---------   ---------------------------------------   genbank     GenBank Release 120.0 flatfiles
                     ncbi-asn1   ASN.1 data used to create Release 120.0

  Uncompressed, the Release 120.0 flatfiles require roughly 36464 MB
(sequence files only) or 40709 MB (including the 'index' files).  The
ASN.1 version requires roughly 32594 MB. From the release notes:

   Release  Date       Base Pairs   Entries

   119      Aug 2000   9545724824   8214339
   120      Oct 2000  10335692655   9102634

  Close-of-data was 10/11/2000. Seven days were required to prepare this
release. In the eight-week period between close-of-data for GenBank 119.0
and GenBank 120.0, GenBank grew by 0.790 billion basepairs and 888,295
sequence records, breaking the 10 Gbp threshold. The most recent doubling
of the database's size has occurred in less than ten months.

  For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 120.0 and Upcoming Changes) have been appended below.

  *NOTE* The gbrod.seq data file is at 248 MB in this release, so it is
likely to be split into two pieces for GenBank 121.0 . This wasn't noticed
in time for inclusion in the Upcoming Changes section of the release notes.

  Release 120.0 data are currently available via NCBI's Entrez and Blast
servers, and the 'query' email server.

  New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 120.0 close-of-data, should be
available by 10:00am EDT, October 19. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 119.0 was

  If you encounter problems while ftp'ing or uncompressing Release 120.0,
please send email outlining your difficulties to info at .

Mark Cavanaugh, Vladimir Alekseyev, Anton Butanaev

1.3 Important Changes in Release 120.0

1.3.1 Organizational changes

  Due to database growth, the EST division is now being split into eighty-seven

  Due to database growth, the GSS division is now being split into twenty-eight

  Due to database growth, the HTG division is now being split into twenty-four

  Due to database growth, the PRI division is now being split into eight pieces.

  Due to database growth, the PAT division is now being split into two pieces:
gbpat1.seq and gbpat2.seq .

1.3.2 Order of entries in the Short Directory file has changed

  The gbsdr.txt file which accompanies GenBank releases contains the
DEFINITION line and number of bases for every sequence. For historical
reasons, a specific division ordering was used for the sections of this
file. This order began with:


and ended with:


  Starting with GenBank Release 120.0, the ordering of the sections
of this file is now determined solely by the sort-order of the 
GenBank division codes. For example:


1.3.3 The gbaut.idx file has been split into multiple pieces

  The gbaut.idx file exceeded 3 GB in size for GenBank 119.0, so it has
been split into seven pieces of approximately 500 MB each:


1.4 Upcoming Changes

1.4.1 NCBI's ftp address will be changed

  At some point in the near future NCBI's ftp address will be changed.
The current address:

will become:

  Additional details about this change will be made available via these
release notes and the GenBank newsgroup (bionet.molbio.genbank) as they
become available.

1.4.2 Selenocysteine representation

  Selenocysteine residues within the protein translations of coding
region features have been represented in GenBank via the letter 'X'
and a /transl_except qualifier. At the May 1999 DDBJ/EMBL/GenBank
collaborative meeting, it was learned that IUPAC plans to adopt the
letter 'U' for selenocysteine.

  DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation
for its /translation qualifiers. Although a timetable for its appearance
has not been finalized, we are mentioning this now because the introduction
of a new residue abbreviation is a fairly fundamental change.

  Details about the use of 'U' will be made available via these release
notes and the GenBank newsgroup as they become available.

1.4.3 New REFERENCE type for on-line journals

  Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that an effort should be made to accomodate references which are
published only on-line. Until specifications for such references are
available from library organizations, GenBank will present them in a manner
like this:

	REFERENCE   1  (bases 1 to 2858)
	  AUTHORS   Smith, J.
	  TITLE     Cloning and expression of a phospholipase gene
	  JOURNAL   Online Publication
	  REMARK    Online-Journal-name; Article Identifier; URL

  This format is still tentative; additional information about this new
reference type will be made available via these release notes.


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list