IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Twenty-nine Records Missing From GB 120.0

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Fri Oct 27 15:10:15 EST 2000


Greetings GenBank Users,

Twenty-nine records that should have been included in GenBank Release 120.0
are missing from the gb*.seq flatfiles due to a processing error in the
database that stores the flatfile versions of GenBank sequence records.

Rather than force these records to be redistributed via the GenBank Update,
we have decided to make them available via a supplemental file on the NCBI
ftp site:

	ftp://ncbi.nlm.nih.gov/genbank/gbsup1.seq.gz

The creation dates of these records range from August 1997 through May 2000,
so all of them have been present in prior GenBank releases. Eighteen of the
records were (coincidentally) updated shortly after the 120.0 close-of-data,
so they are present in the nc1013 incremental GenBank Update, as well as
the GenBank Cumulative Update. Ten of the records (AF114856-AF114865) are
members of a segmented set whose first and last members are AF114855 and
AF114866. Since segmented sets are processed as a unit at NCBI, these two
are also in the supplemental file, bringing the total to 31 records. Complete
lists of the accessions involved are appended below.

The accession numbers of these records are *not* included in the list of
deleted accessions for 120.0 (gbdel.txt). So if you regularly process the
GenBank cumulative/non-cumulative updates to build a local database, and then
perform deletions based on the content of gbdel.txt, then you might not
need to process the supplemental file.

However, users who have completely rebuilt a local database based on the
GenBank 120.0 flatfiles *will* need to obtain the supplemental file, at
least for the 11 missing records that are not present in GenBank Updates
generated since the close.

The files that comprise the ASN.1 version of GenBank 120.0 are not affected
by this problem.

We apologize for any inconvenience that this dataflow problem might have
caused for our users.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH


Eighteen accessions missing from GB 120.0, but present
in the nc1013.flat and gbcu.flat GenBank Updates:

AC010675
AC010796
AC010926
AC011560
AC011622
AC011717
AC012680
AC013289
AC016163
AC016447
AC016662
AC018364
AC018908
AC020579
AC020580
AC021665
AC022288
U95973

Eleven accessions missing from GB 120.0, and not present
in GenBank Updates generated since close-of-data:

AC012679
AF114856
AF114857
AF114858
AF114859
AF114860
AF114861
AF114862
AF114863
AF114864
AF114865

Two accessions that *are* present in GB 120.0, but belong
to the same segmented set as AF114856-AF114865 :

AF114855
AF114866


---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  








More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net