Entrez linking broken

Bradley K.Sherman bks at emf.emf.net
Wed Sep 6 12:09:32 EST 2000


In article <8p4i7u$t0g$1 at mercury.hgmp.mrc.ac.uk>,
Bradley K. Sherman  <bks at emf.emf.net> wrote:
>
>** 
>** Comment from the moderator:
>** Problems like this are best forwarded to NCBI directly,
>** but _also_ appropriate for this newsgroup.
>** NCBI help can be reached at: info at ncbi.nlm.nih.gov
>** cheers,                           francis at cmmt.ubc.ca
>**

Yes I also sent mail to one of the various addresses
listed for help on the NCBI pages.  I would have to
say that the response from NCBI was a bit cryptic, so
I'm offering another pathological example here:

Do a default Basic BLAST
<URL:http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=0>
on the following sequence:

 >fakefasta created Wed Sep  6 09:48:48 PDT 2000
 AGANGAACAAGACAAGAAGAACAAAGTACCCAAGAAAATACACAAGAAGGAAACACAAAG
 ATTGATATTGATCCAAAAGCAATGGCGTACGAGAAAGTCAACGAGCTTAACCTTAAGGAC
 ACAGAGCTATGTCTTGGATTACCCGGAAGAACAGAGAAGATCAAAGAAGAACAAGAGGTT
 TCTTGCGTTATTTGTAACAACAAGCGTCTATTTGAGGAAACTCGTGATGAAGAAGAATCT
 ACACCTCCTACCAAAACTCAAATCGTTGGTTGGCCACCAGTGAGATCTTCCCGTAAGAAC
 AACAACAGTGTGAGCTACGTGAAAGTGAGTATGGCGGAGCTCCTTACCTTCGCAAGATCG
 ATCTCAAGACATACAAAAACTACCCCGAGCTTCTCAAAGCGNTAGAGAATATGTTCAAAG
 NCATGATTGGNGAATATTGNGAGAGAGAAGGATACAAAAGGATCTGGATTTGTCCCACAT
 ACCAAGAAAAAGANGGGGACTGGATGTTGGGTGGGGA

When the results arrive, scroll down to to the best hit,

 gb|L15449.1|ATHIAA2A

And click on it to get another "Query number not found:#1"
error message.

    --bks



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  








More information about the Genbankb mailing list