Close-Of-Data : GenBank 127.0

Mark Cavanaugh cavanaug at
Wed Dec 19 13:56:32 EST 2001

Greetings GenBank Users,

Close-of-data for the upcoming GenBank Release 127.0 occurred
late Monday, December 17, at midnight EST.

The subsequently generated non-cumulative GenBank Update
files nc1218.aso and nc1218.flat contain data through
the close.

Our apologies for not sending this announcement in advance
of the close; the database-wide LOCUS line change has
impacted the scheduling of release tasks to some extent.

Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list