operon of synthases
R.Jayakumar
jakku at mrna.tn.nic.in
Fri Jun 22 10:43:05 EST 2001
hi...
I need to know the arrangement of genes in the operons that code for
multienzyme complexes like fatty acid synthases and polyketide synthases.
This info will be very useful to identify a potential operon which I have
isolated and characterised partially where the genes look like either of
these two... but I am sort of confused to which I should place this operon
into. I am not that good at biochemistry anyway. So please help me.
thank you
sincerely
jayakumar
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
More information about the Genbankb
mailing list