GenBank Release 124.0 Available
cavanaug at ncbi.nlm.nih.gov
cavanaug at ncbi.nlm.nih.gov
Fri Jun 22 23:04:45 EST 2001
Greetings GenBank Users,
GenBank Release 124.0 is now available via ftp from the National Center
for Biotechnology Information:
Ftp Site Directory Contents
---------------- --------- ---------------------------------------
ncbi.nlm.nih.gov genbank GenBank Release 124.0 flatfiles
ncbi-asn1 ASN.1 data used to create Release 124.0
Uncompressed, the Release 124.0 flatfiles require roughly 46.4 GB
(sequence files only) or 51.7 GB (including the 'index' files). The
ASN.1 version requires roughly 42.4 GB. From the release notes:
Release Date Base Pairs Entries
123 Apr 2001 12418544023 11545572
124 Jun 2001 12973707065 12243766
Close-of-data was 06/17/2001. Five business days were required to prepare
this release. In the eight-week period between close-of-data for GenBank 123.0
and GenBank 124.0, GenBank grew by 0.555 billion basepairs and 698,194
sequence records.
We would like to remind our users that GenBank mirrors are available
at ftp://genbank.sdsc.edu/pub and ftp://bio-mirror.net/biomirror/genbank .
Those who experience slow FTP transfers of large files (entire releases, the
GenBank Cumulative Update, etc) might realize an improvement in transfer
rates from these alternate sites when traffic at the NCBI is high.
For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 124.0 and Upcoming Changes) have been appended below.
**IMPORTANT**
One of the changes described in Section 1.4 is a redefinition of the
LOCUS line of the GenBank flatfile format, to be introduced in December
of 2001. Every record in GenBank will be affected. If you parse the LOCUS
line of the flatfile, please pay special attention to this upcoming change!
Also note that some changes have been made to the new LOCUS format since
Release 123.0, also described below.
Release 124.0 data are currently available via NCBI's Entrez and Blast
servers, and the 'query' email server.
New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 124.0 close-of-data, should be
available by 07:00am EDT, June 23. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 123.0 was
posted.
If you encounter problems while ftp'ing or uncompressing Release 124.0,
please send email outlining your difficulties to info at ncbi.nlm.nih.gov .
Mark Cavanaugh, Vladimir Alekseyev, Anton Butanaev
GenBank
NCBI/NLM/NIH
1.3 Important Changes in Release 124.0
1.3.1 Organizational changes
Due to database growth, the BCT division is now being split into 4 pieces.
Due to database growth, the EST division is now being split into 117 pieces.
Due to database growth, the PAT division is now being split into 3 pieces.
Due to database growth, the PRI division is now being split into 12 pieces.
1.3.2 Unusual decrease in number of sequence files for HTG and STS
In this release, the number of HTG division sequence files has decreased to
twenty-four; there were 25 HTG files in Release 123.0. This unusual
reduction is due to: a) on-going finishing work which results in records
moving from HTG to PRI; b) the incorporation of smaller "draft" HTG records
into larger, hence fewer, Phase2 (HTG) and Phase3 (PRI) records.
The STS division also experienced an unusual decrease in the number of
sequence data files. The Release 123.0 gbsts3.seq file only contained a
handful of records, and was created simply because gbsts2.seq exceeded
a file size limit of 250MB . In this release, although there are some
new STS sequences, the nature of some updates to other records has yielded
some smaller record sizes, and thus two sequence files again suffice.
1.4 Upcoming Changes
1.4.1 LOCUS line format change : to accomodate longer names and sequences
When the LOCUS line format for the GenBank flatfile was designed nearly
two decades ago, sequences over 10 Mbp in length were not anticipated. As
a result, the maximum length of a LOCUS name is nine characters, and the
maximum length of a sequence is 9,999,999 bases :
---------+---------+---------+---------+---------+---------+---------+---------
1 10 20 30 40 50 60 70 79
LOCUS AB000383 5423 bp DNA circular VRL 05-FEB-1999
Positions Contents
--------- --------
01-05 LOCUS
06-12 spaces
13-21 Locus name
22-22 space
23-29 Length of sequence, right-justified
31-32 bp
34-36 Blank, ss- (single-stranded), ds- (double-stranded), or
ms- (mixed-stranded)
37-42 Blank, DNA, RNA, tRNA (transfer RNA), rRNA (ribosomal RNA),
mRNA (messenger RNA), uRNA (small nuclear RNA), snRNA
43-52 Blank (implies linear) or circular
53-55 The division code (see Section 3.3)
63-73 Date, in the form dd-MMM-yyyy (e.g., 15-MAR-1991)
This has les to several problems: a) meaningful names of more than nine
characters cannot be utilized; b) the nine-character limit causes LOCUS
names to be truncated for many segmented sets of more than ten members
(see AF272557, AF272558, etc); c) invalid LOCUS lines result when the
GenBank flatfile format is used to display other types of sequence data.
For (c), consider human contig Hs22_11677 derived from primary (archival)
sequences in the HTG division of GenBank:
LOCUS Hs22_1167722998459 bp DNA PRI 10-FEB-2001
DEFINITION Homo sapiens chromosome 22 working draft sequence segment.
ACCESSION NT_011520
The LOCUS name ( Hs22_11677 ) collides with the sequence length ( 22998459 )
due to the restrictions of the LOCUS line format.
To address the LOCUS problems, a new LOCUS line format which allows names
of up to 16 characters, sequences of up to 99,999,999,999 bases, and a uniform
number of data values (eight) will be utilized for all GenBank records starting
with Release 127.0 in December 2001.
There have been several changes to this new format since it was originally
announced in April 2001. Because a new molecule type of snoRNA was approved at
a recent GenBank/EMBL/DDBJ collaborative meeting, the molecule type has been
increased to 6 characters. An additional space was reserved in case 7 character
molecule types ever appear. This reduced the space available for LOCUS names
from 18 character to 16 characters. Lastly, we realized that the presence of
spaces for linear molecules and 'circular' for circular molecules makes simple
token-based parsing of the LOCUS line a harder task. So 'linear' will be
present in the new LOCUS format.
The last change is also to encourage software developers to switch to a
token-based LOCUS parsing approach, rather than a column-specific approach.
If this is done, then future changes to the LOCUS line that affect the spacing
of the data values will not require any software changes.
Because of these changes, we are delaying the introduction of the new format
by two more months (Release 127.0 in December 2001). Here is the revised LOCUS
line format:
---------+---------+---------+---------+---------+---------+---------+---------
1 10 20 30 40 50 60 70 79
LOCUS 16Char_LocusName 99999999999 bp ss-snoRNA circular DIV DD-MMM-YYYY
Positions Contents
--------- --------
01-05 LOCUS
06-12 spaces
13-28 Locus name
31-31 space
30-40 Length of sequence, right-justified
41-41 space
42-43 bp
44-44 space
45-47 spaces, ss- (single-stranded), ds- (double-stranded), or
ms- (mixed-stranded)
48-53 NA, DNA, RNA, tRNA (transfer RNA), rRNA (ribosomal RNA),
mRNA (messenger RNA), uRNA (small nuclear RNA), snRNA,
snoRNA. Left justified.
54-55 space
56-63 'linear' followed by two spaces, or 'circular'
64-64 space
65-67 The division code (see Section 3.3)
68-68 space
69-79 Date, in the form dd-MMM-yyyy (e.g., 15-MAR-1991)
Here's how two existing records will appear using this new format:
LOCUS AB000383 5423 bp DNA circular VRL 05-FEB-1999
DEFINITION Leucania seperata nuclear polyhedrosis virus DNA for p13, xe,
envelope protein, complete cds.
ACCESSION AB000383
LOCUS AF345888 147 bp ss-RNA linear VRL 21-JUN-2001
DEFINITION Chikungunya virus nonstructural protein 4 gene, partial cds.
ACCESSION AF345888
Sample GenBank flatfiles utilizing the new LOCUS line format will be made
available after Releases 125.0 (August) and 126.0 (October), so that developers
can test software that parses GenBank flatfiles. Further announcements about
the LOCUS line change will be made via these release notes and the GenBank
newsgroup (bionet.molbio.genbank).
1.4.2 NCBI's ftp address will be changed
At some point in the near future NCBI's ftp address will be changed.
The current address:
ncbi.nlm.nih.gov
will become:
ftp.ncbi.nih.gov
Additional details about this change will be made available via these
release notes and the GenBank newsgroup (bionet.molbio.genbank) as they
become available.
1.4.3 Selenocysteine representation
Selenocysteine residues within the protein translations of coding
region features have been represented in GenBank via the letter 'X'
and a /transl_except qualifier. At the May 1999 DDBJ/EMBL/GenBank
collaborative meeting, it was learned that IUPAC plans to adopt the
letter 'U' for selenocysteine.
DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation
for its /translation qualifiers. Although a timetable for its appearance
has not been finalized, we are mentioning this now because the introduction
of a new residue abbreviation is a fairly fundamental change.
Details about the use of 'U' will be made available via these release
notes and the GenBank newsgroup as they become available.
1.4.4 New REFERENCE type for on-line journals
Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that an effort should be made to accomodate references which are
published only on-line. Until specifications for such references are
available from library organizations, GenBank will present them in a manner
like this:
REFERENCE 1 (bases 1 to 2858)
AUTHORS Smith, J.
TITLE Cloning and expression of a phospholipase gene
JOURNAL Online Publication
REMARK Online-Journal-name; Article Identifier; URL
This format is still tentative; additional information about this new
reference type will be made available via these release notes.
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
More information about the Genbankb
mailing list