IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

GenBank 124.0 : Five uncompressed files

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Mon Jun 25 10:16:14 EST 2001

Greetings GenBank Users,

Five GSS sequence files of GenBank 124.0 were installed
on the NCBI ftp site on Friday June 22 without compression :

-rw-rw-r--   1 cavanaug gbrel    250002284 Jun 22 02:06 gbgss33.seq
-rw-rw-r--   1 cavanaug gbrel    250002581 Jun 22 02:07 gbgss34.seq
-rw-rw-r--   1 cavanaug gbrel    250003106 Jun 22 02:07 gbgss35.seq
-rw-rw-r--   1 cavanaug gbrel    250001038 Jun 22 02:07 gbgss36.seq
-rw-rw-r--   1 cavanaug gbrel    162261863 Jun 22 02:08 gbgss37.seq

These files have now been compressed:

-r--r--r--   1 cavanaug gbrel    37199286 Jun 25 11:10 gbgss33.seq.gz
-r--r--r--   1 cavanaug gbrel    34839681 Jun 25 11:10 gbgss34.seq.gz
-r--r--r--   1 cavanaug gbrel    34268311 Jun 25 11:10 gbgss35.seq.gz
-r--r--r--   1 cavanaug gbrel    35950643 Jun 25 11:10 gbgss36.seq.gz
-r--r--r--   1 cavanaug gbrel    17555011 Jun 25 11:10 gbgss37.seq.gz

Our apologies for any inconvenience this may have caused.

Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  

More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net