Multi-Genbank submissions into Sequin

Paul Shinn pshinn at
Wed Aug 28 15:52:47 EST 2002

   Hi, I need to view the multiple Genbank submissions in Sequin.  I 
plan to use Batch Entrez to retrieve ~100 submissions.  I'd like to 
retain all the original annotations that are in the submissions.  How 
can I import all these into Sequin?  I've done batch submissions but we 
then annotate in Sequin and then submit.  I've never done the reverse 
successfully.  If I load the file with a 100 different submissions, 
Sequin opens up a 100 different windows.  I just want the one window 
where I can scroll down the list of accession numbers from entry to 
entry.  I can write a script if I need to reformat it for Sequin, but 
I'm not sure what format it should be in.

					Thanks, Paul

Paul Shinn                   pshinn at
Sequencing Coordinator
(858) 453-4100 ext 1796

- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list