Multi-Genbank submissions into Sequin

Paul Shinn pshinn at mail1.sas.upenn.edu
Wed Aug 28 15:52:47 EST 2002


   Hi, I need to view the multiple Genbank submissions in Sequin.  I 
plan to use Batch Entrez to retrieve ~100 submissions.  I'd like to 
retain all the original annotations that are in the submissions.  How 
can I import all these into Sequin?  I've done batch submissions but we 
then annotate in Sequin and then submit.  I've never done the reverse 
successfully.  If I load the file with a 100 different submissions, 
Sequin opens up a 100 different windows.  I just want the one window 
where I can scroll down the list of accession numbers from entry to 
entry.  I can write a script if I need to reformat it for Sequin, but 
I'm not sure what format it should be in.

					Thanks, Paul

--
Paul Shinn                   pshinn at neomorph.salk.edu
SIGnAL                       http://signal.salk.edu
Sequencing Coordinator       http://genome.salk.edu
(858) 453-4100 ext 1796


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list