GbUpdate : nc0131 Install Problem

Mark Cavanaugh cavanaug at
Fri Feb 1 21:13:01 EST 2002

Greetings GenBank Users,

Due to network file system problems, the nc0131 GenBank Update
products were not installed correctly at the NCBI FTP site on
the morning of 1/31/2002 .

The following update files were affected:


The files were manually installed on our FTP site on the
evening of 02/01/2002, at approximately 5:40pm EST.

As a result, the nc0131 update files have appeared out-of-order,
*after* the nc0201 update files were made available (installed at
about 3:20am EST).

There is no overlap in the accession content of the nc0131 and
nc0201 updates (fortunately).

Users/software should always examine the update-dates of sequence
records for reversions. In the event that incremental files are
made available or processed out of order, a check of update-date
values can prevent an earlier version of a record from replacing
a more recent version.

Our apologies for any inconvenience that this installation 
problem may have caused.

Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list