GenBank CU Problem : Post Release 132.0

Mark Cavanaugh cavanaug at
Fri Nov 8 12:13:43 EST 2002

Greetings GenBank Users,

Some of you have no doubt noticed that there is still
no post-132.0 GenBank Cumulative Update available at
the NCBI website:

Unfortunately, a problem occurred with one of our replicant
sequence databases. Since we dump from the replicant side in 
order to generate our update products, we haven't been able
to generate a new CU .

We hope to provide the post-132.0 CU by Saturday morning.
Our apologies for any inconvenience that this CU downtime
may have caused.

Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list