GbUpdate : New CON-division Update Product

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Thu Jan 9 17:21:21 EST 2003


Greetings GenBank Users,

An experimental CON-division file has been included with GenBank releases
since December of 1999. More information about CON-division records can be
found in this README at the NCBI ftp site:

	ftp://ftp.ncbi.nih.gov/genbank/README.genbank

and in this NCBI News article:

	http://www.ncbi.nlm.nih.gov/Web/Newsltr/Fall99/contig.html

Starting on Wednesday, January 15, a new class of incremental-update product
for CON-division records will be made available, in these directories :

	ftp://ftp.ncbi.nih.gov/ncbi-asn1/daily-nc/
	ftp://ftp.ncbi.nih.gov/genbank/daily-nc/

The files will utilize these naming conventions (respectively) :

	con_nc.MMDD.aso.gz   (ASN.1)
	con_nc.MMDD.flat.gz  (GenBank Flatfile)

As described in README.genbank, CON-division records can be generated for:
a) complete genomes that have been split into pieces; and b) 'segmented sets',
utilized for genes/regions that have been incompletely sequenced.

Initially, only complete-genome CON-division records will be present in
the new data products. The submission rate of complete-genomes is
currently relatively low, so there will often be no con_nc* files on any
given day .

A sample CON-division record is enclosed below. CON records have no coding
region annotation and no actual sequence data, so there will be no GenPept,
protein-FASTA, or nucleotide-FASTA versions of the incremental CON-division
data product.

Mark Cavanaugh
GenBank



Sample CON-division flatfile :

LOCUS       AE015929             2499279 bp    DNA     circular CON 02-JAN-2003
DEFINITION  Staphylococcus epidermidis ATCC 12228, complete genome.
ACCESSION   AE015929
VERSION     AE015929.1  GI:27316888
KEYWORDS    .
SOURCE      Staphylococcus epidermidis ATCC 12228
  ORGANISM  Staphylococcus epidermidis ATCC 12228
            Bacteria; Firmicutes; Bacillales; Staphylococcus.
REFERENCE   1  (bases 1 to 2499279)
  AUTHORS   Zhang,Y., Ren,S., Li,H., Fu,G., Lu,L., Lu,G., Jia,J., Tu,Y.,
            Qin,Z., Chen,Z. and Wen,Y.
  TITLE     Direct Submission
  JOURNAL   Submitted (05-NOV-2002) Chinese National Human Genome Center at
            Shanghai, 250 Bi Bo Road, Shanghai 201203, China
FEATURES             Location/Qualifiers
     source          1..2499279
                     /organism="Staphylococcus epidermidis ATCC 12228"
                     /strain="ATCC 12228"
                     /db_xref="ATCC:12228"
                     /db_xref="taxon:176280"
CONTIG      join(AE016744.1:1..300787,AE016745.1:61..300242,
            AE016746.1:61..303211,AE016747.1:61..300892,AE016748.1:61..300029,
            AE016749.1:61..302823,AE016750.1:61..300698,AE016751.1:61..300275,
            AE016752.1:61..90802)
//


Sample CON-division ASN.1 :


Seq-entry ::= seq {
  id {
    genbank {
      accession "AE015929" ,
      version 1 } ,
    gi 27316888 } ,
  descr {
    source {
      genome genomic ,
      org {
        taxname "Staphylococcus epidermidis ATCC 12228" ,
        db {
          {
            db "taxon" ,
            tag
              id 176280 } ,
          {
            db "ATCC" ,
            tag
              id 12228 } } ,
        orgname {
          name
            binomial {
              genus "Staphylococcus" ,
              species "epidermidis" } ,
          mod {
            {
              subtype strain ,
              subname "ATCC 12228" } } ,
          lineage "Bacteria; Firmicutes; Bacillales; Staphylococcus" ,
          gcode 11 ,
          div "BCT" } } } ,
    pub {
      pub {
        sub {
          authors {
            names
              std {
                {
                  name
                    name {
                      last "Zhang" ,
                      first "Yueqing" ,
                      initials "Y." } } ,
                {
                  name
                    name {
                      last "Ren" ,
                      first "Shuangxi" ,
                      initials "S." } } ,
                {
                  name
                    name {
                      last "Li" ,
                      first "Hualing" ,
                      initials "H." } } ,
                {
                  name
                    name {
                      last "Fu" ,
                      first "Gang" ,
                      initials "G." } } ,
                {
                  name
                    name {
                      last "Lu" ,
                      first "Lingfeng" ,
                      initials "L." } } ,
                {
                  name
                    name {
                      last "Lu" ,
                      first "Gang" ,
                      initials "G." } } ,
                {
                  name
                    name {
                      last "Jia" ,
                      first "Jia" ,
                      initials "J." } } ,
                {
                  name
                    name {
                      last "Tu" ,
                      first "Yuefeng" ,
                      initials "Y." } } ,
                {
                  name
                    name {
                      last "Qin" ,
                      first "Zhiqiang" ,
                      initials "Z." } } ,
                {
                  name
                    name {
                      last "Chen" ,
                      first "Zhu" ,
                      initials "Z." } } ,
                {
                  name
                    name {
                      last "Wen" ,
                      first "Yumei" ,
                      initials "Y." } } } ,
            affil
              std {
                affil "Chinese National Human Genome Center at Shanghai" ,
                city "Shanghai" ,
                country "China" ,
                street "250 Bi Bo Road" ,
                email "rensx at chgc.sh.cn" ,
                fax "(8621)50801922" ,
                phone "(8621)50801919" ,
                postal-code "201203" } } ,
          medium other ,
          date
            std {
              year 2002 ,
              month 11 ,
              day 5 } } } } ,
    title "Staphylococcus epidermidis ATCC 12228, complete genome" ,
    molinfo {
      biomol genomic ,
      completeness complete } ,
    create-date
      std {
        year 2002 ,
        month 12 ,
        day 20 } ,
    update-date
      std {
        year 2003 ,
        month 1 ,
        day 2 } } ,
  inst {
    repr seg ,
    mol dna ,
    length 2499279 ,
    topology circular ,
    strand ds ,
    ext
      seg {
        int {
          from 0 ,
          to 300786 ,
          strand plus ,
          id
            gi 27314460 } ,
        int {
          from 60 ,
          to 300241 ,
          strand plus ,
          id
            gi 27314765 } ,
        int {
          from 60 ,
          to 303210 ,
          strand plus ,
          id
            gi 27315075 } ,
        int {
          from 60 ,
          to 300891 ,
          strand plus ,
          id
            gi 27315369 } ,
        int {
          from 60 ,
          to 300028 ,
          strand plus ,
          id
            gi 27315631 } ,
        int {
          from 60 ,
          to 302822 ,
          strand plus ,
          id
            gi 27315920 } ,
        int {
          from 60 ,
          to 300697 ,
          strand plus ,
          id
            gi 27316220 } ,
        int {
          from 60 ,
          to 300274 ,
          strand plus ,
          id
            gi 27316530 } ,
        int {
          from 60 ,
          to 90801 ,
          strand plus ,
          id
            gi 27316792 } } ,
    hist {
      assembly {
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27314460 } ,
              starts {
                0 ,
                0 } ,
              lens {
                300787 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27314765 } ,
              starts {
                300727 ,
                0 } ,
              lens {
                300242 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27315075 } ,
              starts {
                600909 ,
                0 } ,
              lens {
                303211 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27315369 } ,
              starts {
                904060 ,
                0 } ,
              lens {
                300892 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27315631 } ,
              starts {
                1204892 ,
                0 } ,
              lens {
                300029 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27315920 } ,
              starts {
                1504861 ,
                0 } ,
              lens {
                302823 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27316220 } ,
              starts {
                1807624 ,
                0 } ,
              lens {
                300698 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27316530 } ,
              starts {
                2108262 ,
                0 } ,
              lens {
                300275 } ,
              strands {
                plus ,
                plus } } } ,
        {
          type partial ,
          dim 2 ,
          segs
            denseg {
              dim 2 ,
              numseg 1 ,
              ids {
                gi 0 ,
                gi 27316792 } ,
              starts {
                2408477 ,
                0 } ,
              lens {
                90802 } ,
              strands {
                plus ,
                plus } } } } } } }

---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list