how to retrieve exons of Human sapien from Genbank

yan mingdi yan_mingdi at hotmail.com
Sat Nov 8 17:37:32 EST 2003


=A0

Hi, there,
=A0
Anybody know how to get exons from the nucleotide sequeces of Human sapien =
downloaded from Genbank? My purpose is
to get the splice juction sites(donor sites and acceptor site). Appreciate=
=A0help form anybody. Thank you.=A0
=A0
mingdi

___________________________________________________________________________=
_______________________________________________

Add photos to your e-mail with MSN 8. Get 2 months FREE*. ---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/      =20
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb     =
=20
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca            =
     =20





More information about the Genbankb mailing list