how to retrieve exons of Human sapien from Genbank

yan mingdi yan_mingdi at
Sat Nov 8 17:37:32 EST 2003


Hi, there,
Anybody know how to get exons from the nucleotide sequeces of Human sapien =
downloaded from Genbank? My purpose is
to get the splice juction sites(donor sites and acceptor site). Appreciate=
=A0help form anybody. Thank you.=A0


Add photos to your e-mail with MSN 8. Get 2 months FREE*. ---

- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:      =20
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb     =
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at            =

More information about the Genbankb mailing list