how to retrieve exons of Human sapien from Genbank
Staffa, Nick (NIH/NIEHS)
staffa at niehs.nih.gov
Fri Nov 14 09:45:24 EST 2003
> For known genes and/or sequence for which mRNA exists, the sequence is
> annotated with the exons described in the CDNA record, or the mRNA record
> in the super contig. Most of the work that you could possibly do to find
> exons, introns et c. has been done for you already, and is annotated in
> the super contig.
> Sometimes genes can be found my finding their homologues in other species
> and using NCBI's blast.
>
>
>
>
Nick Staffa
Telephone: 919-316-4569 (NIEHS: 6-4569)
Scientific Computing Support Group
NIEHS Information Technology Support Services Contract
(Science Task Monitor: John Grovenstein, DIR)
National Institute of Environmental Health Sciences
National Institutes of Health
Research Triangle Park, North Carolina
> ----------
> From: yan mingdi
> Sent: Saturday, November 8, 2003 5:37 PM
> To: genbank at net.bio.net
> Subject: how to retrieve exons of Human sapien from Genbank
>
>
> =A0
>
> Hi, there,
> =A0
> Anybody know how to get exons from the nucleotide sequeces of Human sapien
> =
> downloaded from Genbank? My purpose is
> to get the splice juction sites(donor sites and acceptor site).
> Appreciate=
> =A0help form anybody. Thank you.=A0
> =A0
> mingdi
>
> __________________________________________________________________________
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca
More information about the Genbankb
mailing list