what kind of changes do researchers want to know from updated files in

#TAN SHIN YEE# 800728075642 at ntu.edu.sg
Sun Sep 7 23:41:14 EST 2003


hi,
 
I'm a student doing my final year project. Could someone please help
me to find out this or show me references about this topic :
 
other than sequence changes, what kind of changes / update do the
bio-scientiests and researchers would like to find out from old files
and updated files in genbank? 
 
Thank you very much.
 
Rdgs,
Tan Shin Yee 800728075642 at ntu.edu.sg
---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list