GB Release 141.0 Problem : rel141.fsa_aa
Mark Cavanaugh
cavanaug at ncbi.nlm.nih.gov
Mon Apr 26 14:23:41 EST 2004
Greetings GenBank Users,
The FASTA file for proteins that are annotated as coding regions on GenBank
records which was installed on Saturday, April 24th:
-r--r--r-- 1 cavanaug gbrel 301055803 Apr 24 22:01 rel141.fsa_aa.gz
contained 13,814 duplicated sequences as a result of incorrectly processing
one of the classes of data that contributes to the CON division of Release 141.0.
This problem was fixed on Monday, April 26th and a new version of the
file was installed at about 2:00pm EDT:
-r--r--r-- 1 cavanaug gbrel 299081010 Apr 26 14:01 rel141.fsa_aa.gz
Our thanks to a user at Novartis for pointing out the problem. The scrutiny
of data products provided by GenBank users is greatly appreciated by NCBI.
Mark Cavanaugh
GenBank
NCBI/NLM/NIH/DHHS
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca
More information about the Genbankb
mailing list