GB Release 141.0 Problem : rel141.fsa_aa

Mark Cavanaugh cavanaug at
Mon Apr 26 14:23:41 EST 2004

Greetings GenBank Users,

The FASTA file for proteins that are annotated as coding regions on GenBank
records which was installed on Saturday, April 24th:

   -r--r--r--   1 cavanaug gbrel    301055803 Apr 24 22:01 rel141.fsa_aa.gz

contained 13,814 duplicated sequences as a result of incorrectly processing
one of the classes of data that contributes to the CON division of Release 141.0.

This problem was fixed on Monday, April 26th and a new version of the 
file was installed at about 2:00pm EDT:

   -r--r--r--   1 cavanaug gbrel    299081010 Apr 26 14:01 rel141.fsa_aa.gz

Our thanks to a user at Novartis for pointing out the problem. The scrutiny
of data products provided by GenBank users is greatly appreciated by NCBI.

Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list