Content Problem in 0901 GenBank Update

Mark Cavanaugh cavanaug at ncbi.nlm.nih.gov
Wed Sep 1 17:10:30 EST 2004


Greetings GenBank Users,

Due to an error in a timestamp file that is used to control the 
content of the GenBank Update, 10,427 records that originated
from the journal-scanning effort of the early 1990's were erroneously
included in the 0901 GenBank Update products.

The update-dates on the LOCUS lines of the GenBank flatfile product
for these records range from 06-MAY-1993 through 25-AUG-2004. All of
these records have accessions beginning with the prefix 'S' .

In addition, 5,294 Direct-Submission sequence records which were
distributed in the 0831 GenBank Update products were erroneously
re-distributed in the 0901 products (due to the same timestamp 
problem).

We do not expect the presence of these records to have caused any
problems for anyone who processes the 0901 update.

However, it is possible that users' systems may have issued warnings
about old update-dates, or byte-identical records. So an 
explanation of the cause seemed appropriate.

Our apologies for any inconvenience that this 0901 content problem
may have caused.

Regards,

Mark Cavanaugh
GenBank
NCBI/NLM/NIH/HHS
---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca                  





More information about the Genbankb mailing list