are there predicted mRNA sequences in GenBank

Francis Clark fc at
Wed Apr 20 02:45:06 EST 2005


I collect up mRNA sequences from the main GenBank flat files (for
example, the gbpri*.seq files) in order to add to collections of
transcripts derived from the est and htc files.

I've been trying to work out if any of these "mRNA" sequences are
predicted, rather than being bona fide (possibly partial) mRNAs
that someone somewhere has sequenced. I mean predicted in the
sense of being a predicted splicing of sequenced DNA. I have
previously encountered a similar sort of problem, where,
apparently, mRNA sequences have been annotated as DNA. In any

Are any of the "mRNA" sequences in GenBank predicted, and if so
what is the best approach to identifying them?

Any help with this will be greatly appreciated,


Francis Clark, PhD
Research Fellow,
Advanced Computational Modelling Centre, and 
ARC Centre in Bioinformatics,
University of Queensland,


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list