GenBank : removal of MEDLINE linetype

Mark Cavanaugh cavanaug at
Tue Feb 15 11:21:27 EST 2005

Greetings GenBank Users,

The PUBMED linetype was introduced in December of 1997,
as a way of linking references in sequence records to
the PubMed biomedical literature database, based on a
PubMed ID (PMID) .

Since then, we have been displaying both the PMID and
its predecessor (Medline Unique ID / MUID) for all
references. For example :

LOCUS       ECOGUABA                3531 bp    DNA     linear   BCT
DEFINITION  Escherichia coli guaBA operon operon, complete sequence.
ACCESSION   M10101 M10102
VERSION     M10101.1  GI:146274
REFERENCE   1  (bases 1768 to 3531)
  AUTHORS   Tiedeman,A.A., Smith,J.M. and Zalkin,H.
  TITLE     Nucleotide sequence of the guaA gene encoding GMP synthetase of
            Escherichia coli K12
  JOURNAL   J. Biol. Chem. 260 (15), 8676-8679 (1985)
  MEDLINE   85261223
   PUBMED   3894345

Subsequent to 1997, PMID article identifiers subsumed MUIDs.
Some background information about that evolution can be found at:

Starting with GenBank Release 147.0 in April of 2005, the older
MEDLINE linetype will be displayed in GenBank sequence records
only for (very rare) articles that lack a PMID identifier.

For the vast majority of cases, this means that the MEDLINE
linetype will no longer be displayed; only the PUBMED identifier
will be presented.


Mark Cavanaugh


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list