Information about an EST sequence

[iso-8859-1] BERNARDI C=E9line CBERNARDI at rd.loreal.com
Thu Mar 24 10:48:04 EST 2005


Dear Mr Cavanaugh,

Thank you for these information.

In the meantime, I went on with my search, and I found that on EMBL, with
the following link:

http://www.ebi.ac.uk/cgi-bin/sva/sva.pl?query=3DAI791495&search=3DGo&snapsh=
ot=3D

I can have the whole history of the modifications (and I got the informatio=
n
I wanted, i.e. the sequence was not modified).

Thank you again for your help,

Best regards,
C=E9line BERNARDI

-----Message d'origine-----
De : Cavanaugh, Mark (NIH/NLM/NCBI) [mailto:cavanaug at ncbi.nlm.nih.gov]=20
Envoy=E9 : jeudi 24 mars 2005 16:38
=C0 : 'genbankb at net.bio.net'; BERNARDI C=E9line
Objet : RE: Information about an EST sequence


Dear Dr. Bernardi,

Because of the way that EST and GSS sequences are processed at GenBank, we
do not have a version of AI791495 as it appeared on 7/2/1999, and=20
thus we cannot compare that version to the record's current state. However,
I *can* tell you that the update did not affect the sequence.

I have asked dbEST staff to check their correspondence: perhaps the nature
of the 12/13/1999 update will be indicated there. If not... perhaps a site
somewhere has archived a copy of the August 1999 GenBank release (113.0),
and AI791495 can be extracted from one of the EST sequence files?=20

We do not archive old releases ourselves... but perhaps some reader of this
forum knows of a site that does?

We will contact you if our search of the correspondence from EST submitters
reveals any information about AI791495 .

Regards,

Mark Cavanaugh
GenBank
NCBI/NLM/NIH/HHS


>From: [iso-8859-1] BERNARDI C=3DE9line [mailto:CBERNARDI at rd.loreal.com]
>Sent: Thursday, March 24, 2005 9:29 AM
>To: genbank at net.bio.net
>Subject: Information about an EST sequence
>
>Dear Sirs,=3D20
>
>I send you this email in order to have specific information
>about the EST
>which has the Accession number AI791495.=3D20
>
>Indeed, I have seen that this sequence was first seen at NCBI
>on July 2,
>1999; it was then updated on December 13, 1999.
>
>How can I see the first version (of July 2)? Is it possible to see the=20
>different modifications which occurred between July 2 and December 13?
>
>Thank you in advance for your response,=3D20
>
>Best regards,=3D20
>C=3DE9line BERNARDI=3D20


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/      =20
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb     =
=20
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at bioinformatics.ubc.ca  =
               =20





More information about the Genbankb mailing list