Information about an EST sequence

Cavanaugh, Mark (NIH/NLM/NCBI) cavanaug at
Fri Mar 25 18:13:51 EST 2005

Thanks for passing along the information about EMBL's SVA.

NCBI does provide access to all old versions of non-EST records.
For example, try accession AC074315 at this URL :

However, this functionality does not extend to EST sequences
**unless** a sequence change is involved. So the EMBL SVA is a
nice complementary resource .


Mark Cavanaugh

>From: [iso-8859-1] BERNARDI C=E9line [mailto:CBERNARDI at] 
>Sent: Thursday, March 24, 2005 10:48 AM
>To: genbank at
>Subject: RE : Information about an EST sequence
>Dear Mr Cavanaugh,
>Thank you for these information.
>In the meantime, I went on with my search, and I found that on 
>EMBL, with
>the following link:
>I can have the whole history of the modifications (and I got 
>the informatio=
>I wanted, i.e. the sequence was not modified).
>Thank you again for your help,
>Best regards,

- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
- GenBank newsgroup see:       
- GENBANKB e-mail: messages sent to genbankb at
- subscribe: e-mail biosci-server at with: subscribe genbankb
- unsub: e-mail biosci-server at with: unsubscribe genbankb      
- GenBank on the WWW, see:
- problems with GENBANKB? E-mail moderator: francis at                  

More information about the Genbankb mailing list