STS design!

SURESH NAIK suresh at aripune.ernet.in
Fri Oct 10 08:24:22 EST 1997


Hello to all:

I am into designing some STS primers from sequences in wheat.  They are
RAPD products.  I need some suggestions from someone who has designed
quite many.
here is an example
1:- CCCGGCATAAGTCTATGGTT

is a primer suggested

2:-  CGGCATAAGTCTATGGTT

is another.  Both neccessarilly are same just that second one lacks two
GGs at 5' end.  Which one would you suggest will give good results, and
why? Why would one reject one while selecting anothe.

Any suggestion and information in this would be highly appreciated.

Thanks in advance
Warm Regards
SURESH
++++++++++++++++++++++++++++++++++
SURESH NAIK
Plant Molecular Biology Unit
Biochemical Sciences Division
National Chemical Laboratory (NCL)
Pune 411 008
INDIA
Phone/Fax: +91-212-338234
email: suresh at aripune.ernet.in
++++++++++++++++++++++++++++++++++++++++++






More information about the Maize mailing list