Missouri Maize Project announces 47 Newly Mapped SSR's

Mary Polacco maryp at teosinte.agron.missouri.edu
Thu Dec 2 19:30:56 EST 1999


The  Missouri Maize Project announces some 47 newly mapped SSR primer pairs
which may also be accessed at MaizeDB,
      http://www.agron.missouri.edu/ssr.html

The below file lists the SSR primer pair name, the bins map location,  GenBank
accessions from which the SSR were detected, and the primers.

Cheers,
mary polacco

  umc1305      1.00- 1.02           AI947344 
CAATTTGATGCTGGGATTCAGATA        TGCTGTGTGTTTGATGCTTTAGTTT
  umc1269      1.01- 1.02           AI941989 
TATATTAGAGGCACCTCCCTCCGT        AGCTGCTTCAGCGACTTTGG
  umc1321      1.03- 1.06           AI901504 
GATTTAAATTAGTAGCCGCCGTCC        CCACCTGCAGATGTACAGAACAGT
  umc1297      1.05- 1.06           AI947917 
TGGTCACTGACTGTTTCGACTAGC        ATCGCCTCAACACACCTTCATATT
  umc1323      1.06- 1.05           AI901470 
TTGCACCCCGTTATTATCCTACAG        CCAGACTAGAGTGCCATGATCCTT
  umc1335      1.06- 1.07           AI861498 
ATGGCATGCATGTGTTTGTTTTAC        ACAGACGTCGCTAATTCCTGAAAG
  umc1298      1.09- 1.10           AI947839 
AGCTGAACAAAATAAACGGAACGA        AGGACAAGAAAAAGAAGAAGCACG
  umc1306      1.09- 1.11           AI944111 
CGAAACAAAACACCCAGCAGTAGT        CCAGGATGAATAAATCGTATTGCC
  umc1326      2.04                 AI881970 
GACCAAAGAATTCCCTCCCCTA          TACCTAGTACTCGGCCAGTTCCTC
  umc1300      3.04- 3.06           AI947741 
TCTGAACGCACTGGGAACATAGTA        AGAATAATGGACGGTTCCTCTGG
  umc1311      3.05- 3.06           AI939856 
CTCGACAACTTTTGGCTTCGTACT        AAAGCGATGCCATCAGAATCTAAG
  umc1320      3.08                 AI902115 
TGCGAAATCTGTATACCATAGGCA        CTCTTTTAGCAGTGTGCCGAATTT
  umc1273      3.08- 3.09           AI948095 
GTTCGCTGCTGCTTCTTATATGCT        AATTGGCGCAGGCTATAGACATTT
  umc1294      4.00- 4.04           AI948003 
GCCGTCAACGGGCTTAAACT            GCCTCCAGCTCTCTCGTCTCTT
  umc1288      4.02- 4.03           AI948003 
ATCCGGACAAATTGAACTTTCATC        ATAGATTCAGTGTTGGACCGAGGA
  umc1303      4.04- 4.05           AI947696 
CTTGGTAGCTTCGTATTCGACGAG        ATCCTAGGAAAGCAGGGAGGG
  umc1317      4.04- 4.07           AI920379 
GCTAATGTTGCCTGTTGGCATAG         CCGACTCCGAGTAGCTTTCGT
  umc1346      4.05                 AI881378 
TCTGATCTCTTCGGTGCTAGAGAAA       AAGAGATCTCCCAACCCTAACTGC
  umc1299      4.06- 4.07           AI947817 
CTTGGGTTCTTCTCTCCTATGGGT        CGCTACAAACAAGTGGCGTTTAAT
  umc1329      4.06- 4.07           AI881613 
CCTCTCACATCTCCTCTCCCCT          GTGTCGGTGTAGGTCTCCGTCTT
  umc1313      4.08- 4.10           AI920754 
GCTGTCTGTGACCAAGTTTCCTCT        TGAAGAACAGGGACGTGATGATAA
  umc1328      4.08- 4.10           AI881634 
TACAAGGAGGAGGCCGCTGT            ATCCAGTCTCCGGACTTCCAAC
  umc1308      5.00- 5.01           AI943731 
GCAGATGGACACAAACAAATGAAG        GCTACTGATGCTGGCAATCTTACA
  umc1315      5.03                 AI920576 
CTTCAGTCCCCTACCTACCCTGAG        GAGTTGGGATGAGCAGCAAGATAG
  umc1341      6.05- 6.07           AF073330 
GTCTACCAGGACGTTTACCTGTGG        CCTCAATCCTTTGTGGACAAACAC
  umc1296      6.06- 6.08           AI947918 
CTCTCCCGGCTCTGACCTAGC           GCTGGAGATAGGCATCCAGACAC
  umc1324      7.03- 7.04           AI901427 
ATCCATCATCATCATCATTGCTTG        ATGTCATCATGTACCAGGTGTTGG
  umc1295      7.03- 7.10           AI947923 
GTCGATCTTCCTCCCCATCA            CGTTTCTATCTATGGAGGAGTGCG
  umc1342      7.04- 7.05           AI944014 
TCTAATCCAATCGACATCGACAGA        TCGCCCTCTTTTCTTTTCTTTTCT
  umc1327      8.01- 8.02           AI881644 
AGGGTTTTGCTCTTGGAATCTCTC        GAGGAAGGAGGAGGTCGTATCGT
  umc1302      8.03- 8.04           AI947718 
ATTTATTCAAACCGACGAAGCAAC        TACAAGCGCTACTGCGATGTCTT
  umc1343      8.04- 8.06           AJ238507 
CTTCCTGGCACGTAACATTACCAT        ATCGGTCTTCCAACCAGATCATTA
  umc1309      8.05                 AJ238507 
CTCTCATTAGTTCGTGCCAGTCAA        CCAGAAATCAGAGGAAGCTCTCAG
  umc1316      8.05                 AI920488 
CAGGGCACATAGTTTCAGATGTTG        GGGATAAGTCTCTCCCTCGTTTGT
  umc1340      8.05                 AI947716 
GATGTCTCTATGGAACCCAGCAAC        GAGACGCCTACGAGTACCACAACT
  umc1287      8.05- 8.06           AI979450 
ATGGGATGATCAGTCGTTTCAGTC        AGAAGGAGGCCCACTACGAGAG
  umc1271      9.02- 9.05           AI948396 
CTCTCCTCGTCCGGTAATTAAGC         GCTTCTTCTTCTTGCGCTTCTCT
  umc1231      9.03- 9.05 
CTGTAGGGCTGAGAAAAGAGAGGG        CGACAACTTAGGAGAACCATGGAG
  umc1310      9.06- 9.08           AI939884 
AACTCCGAGATCTACGACAACAGC        GAGGAAGAGTTGGCCAGGATG
  umc1293     10.00-10.02           AI977907 
GATCTCGATCTGCTTCATCATCTG        GTATCCGTTTCTCATGCAACACAC
  umc1318     10.01-10.02           AI902041 
ACTTCGTCTAGTGTCCCTCCGTT         TGCCAGATTAAAAGCAACACAAGA
  umc1319     10.01-10.03           AI902130 
TGAGAGCCACCTTCTTGAGCTACT        TTCCTTGAAGGCGAAGGTAGGTAT
  umc1345     10.03                 AI881397 
ACCGCAGCAGCAGAGAAGAG            GAACATCTGGGTCACCTCTGTCAT
  umc1312     10.03-10.04           AI932183 
AAAGTTACTGCTGCCAAAGCTGTC        AGATCGAGCGGTGGATATGGT
  umc1336     10.03-10.04           AI861156 
GTACAAATGATAAGCAAGGGGCAG        CTCTGTTTTGGAAGAAGCTTTTGG
  umc1272     10.03-10.05           AI948375 
CTCTGACAGACCTGCAGATAGGGT        ATCGAGGGGCTAATCAGCAAG
  umc1344     10.07                 AB024291 
GCGCTCTGACTTAATTAGAGGAGTTG      GGCAGCAGATCTATGTCCAAGAAG




More information about the Maize mailing list