24 Newly mapped SSR

Mary Polacco maryp at teosinte.agron.missouri.edu
Fri Oct 22 00:06:16 EST 1999


Dear Colleagues:

Newly mapped SSR entered into MaizeDB from the Missouri Maize
Project are provided  below. A complete listing is available at:
 
http://www.agron.missouri.edu/ssr.html

  Respectfully yours,
  Mary Polacco
  Curator MaizeDB
+++++++++++++++++++++++++++++++++++++++++++++++

Fields:
SSR, Bin(s), GenBank accession, forward sequence, reverse sequence

  umc1222      1.02- 1.03 
CTCAGAACAGAAGCCATCAAAAGC        CGTCTTCGTGAGAGACATCCTGT
  umc1073      1.03                 AI396479 
CACCAACGCCAATTAGCATCC           GTGGGCGTGTTCTCCTACTACTCA
  umc1220      1.11 
ATCTTTTTCCTTCCGAGCTGTACG        GTGGACGAGTCCGTGCTCAG
  umc1227      2.01- 2.03 
CAAGTTGGTGAGATGGATCTGTTG        GCTCCTGGGTCTTCCTCTCC
  umc1230      2.08- 2.10 
GCGATTTCAACTATTTGTGGTAAAGG      GTACGACCGTTGAAACTGTTGTTTT
  umc1223      3.04 
TTCAACAGATTCAGAGAAAGCACA        TTGATAATTAATCCGCAGCTCTCTC
  umc1067      4.04                 G10787 
ACTTGTACTACGCAGGACAGTTCG        AGCCTCTGTCTGGATGACTGAAC
  umc1194      4.07- 4.08           AI668269 
ACCACCAGACATGGGAAACTTCT         AAGGCGGACACTACTCTACCCTCT
  umc1050      4.10- 4.11           AI374559 
CGATACACATCCATCTTCAGGTAGC       GCCTTTGTACCAATACAAGCCAAG
  umc1180      4.10- 4.11           X57275 
GAAGCCCCTTGAAATGAATGAAC         CGACGTACGTATAGACTCGCTCAG
  umc1197      4.10- 4.11           L05934 
GGTGTAATTTAGGGAGTGTTTGTTCG      CCGCATAGATGTGCTTTCTAGGAG
  umc1226      5.02- 5.04 
GAACCTACTGACCTGCACGAGAC         TTTTCATCACACAAGAAGCAGCTC
  umc1224      5.02- 5.07 
CTGAGAGGTCCCAAAGGAGTACAA        ATGACCTGCACACAGAAAGAACAA
  umc1098      5.04- 5.07           G49467 
ATAACTCCTGCATCTTGTCAGCAA        CACAGGATAGAACCTTCTCAGCAAA
  umc1192      5.04- 5.07           AI712255 
GATCGAACTGCAGAGGAACAAGAG        CGCTCCACATCCACATCTACAC
  umc1221      5.05- 5.06 
GCAACAGCAACTGGCAACAG            AAACAGGCACAAAGCATGGATAG
  umc1225      5.08 
CTAGCTCCGTGTGAGTGAGTGAGT        TTCCTTCTTTCTTTCCTGTGCAAC
  umc1229      6.00- 6.01 
AAACTTCTCCCCCGCAGTTC            CACCAACTCCACCACGTTCC
  umc1186      6.00- 6.03           U10076 
TCAAGAACATAATAGGAGGCCCAC        AGCCAGCTTGATCTTTAGCATTTG
  umc1138      7.00- 7.02           AI665696 
ATCAGCATCCTCCATTCACACAT         CGGGAAATGCTAGAATTATGCTGA
  umc1141      8.04- 8.07           AI649713 
AGAGGAGAAAGAGACAGACAGGCA        CAGGAACTGAATGAAAGCAACTCA
  umc1161      8.05- 8.09           AI586471 
GGTACCGCTACTGCTTGTTACTGC        GCTCGCTGTTGGTAGCAAGTTTTA
  umc1054     10.03-10.04           AF043346 
CCGTCTTCTTCAGGGTGTTCC           GTGGAGTTAGTAGGGTCGTTGCAC
  umc1196     10.07                 AI622333 
CGTGCTACTACTGCTACAAAGCGA        AGTCGTTCGTGTCTTCCGAAACT


COMMENT: the below SSR have some proprietary contraints;
please refer to the records in MaizeDB for details
      umc1223
      umc1224
      umc1225
      umc1226
      umc1227
      umc1229
      umc1230
      umc1220
      umc1221
      umc1222



More information about the Maize mailing list