Newly Mapped SSRs

Mary Polacco maryp at teosinte.agron.missouri.edu
Fri Aug 4 14:23:21 EST 2000


New SSRs

The Missouri Maize Project has released 116 newly mapped
SSR markers to MaizeDB, see below table.

Note: Some primer pairs  were designed  using the TIGR EST assemblies or

'contigs' and
for these, the below table includes a "TIGR" TC# which you may use to
lookup up the
contig sequence, clone information, and sequence homology where
available.

When our main WWW server goes back online (see previous bulletin),
access to TIGR, GenBank and  MaizeDB details are provided
directly from tables linked to this page:
       http://www.agron.missouri.edu/ssr.html

In the interim, you may  go directly to the TIGR site:
     http://www.tigr.org/tdb/zmgi/searching/reports.html
or to one of the main 'GenBank' sites:
  US        http://www3.ncbi.nlm.nih.gov/Entrez/
  EMBL   http://www.ebi.ac.uk/cgi-bin/emblfetch
  DDBJ   http://ftp2.ddbj.nig.ac.jp:8000/getstart-e.html

Have a great weekend,
     mary

file:/home/maryp/Jul00SSR

--
Mary Polacco, Curator MaizeDB
PolaccoM at missouri.edu
+1 573-884-7873 (phone); -7850 (fax)



  SSR          Bins                  GenBank       TIGR        PrimerF 
PrimerR
  ----------  --------------------  ------------  ---------- 
------------------------------  ------------------------------
  umc1685      1.01 
TAGTTTGAGGGATCAAGAACCACC        GCTCAAAGGCAAGGCAGTATTTTA
  umc1727      1.01                 AW574491 
GGCTGATCTTCTCCGCTTTTAAC         AGGTACAGGTACAAGGCCCAGTC
  umc1711      1.02                 AW600474 
TAGGTTACTCCACAAACAATGGCA        TTGTGTGGTGGCAAGTTTATATGC
  umc1701      1.03                               TC16255 
GCGGCAGTACAACACGTAACAATA        CGCCAATAAACTGGAGGATAAGAA
  umc1770      1.04- 1.05           AW330630 
GAGGGATCATGGCTCTCTTCC           GTCCATCATCAGCCTGTCACC
  umc1689      1.05                               TC13428 
GAGGCGGAGGAGGAACACAG            GAACGAGTAGGGCAGCGTCAG
  umc1703      1.05                               TC12560 
ATTTTCTTGCTCACGTTCACTTCC        TAACGGCAGCATTACATTTCTTGA
  umc1734      1.05                 AW600354 
TTGTGCATTTTGCAGAAACTAGGA        AGTACTTGTCGGTGGAGACTGGAG
  umc1709      1.06                 AW566357 
ATACGTAGCACCTCCAGGTAGCAG        CAGGTACAACGGATGAGGCAG
  umc1748      1.06                 AW506669 
GTGCACGTCATCATAATCATCTCC        CTTCTTTCCCATCATGTTTTCGTT
  umc1754      1.06                 AW455704 
ATAGGGATCGACCCGTTCGT            AATATCTCCGATCCACCAACAAAA
  umc1706      1.07                               TC16745 
ATCGAGAGGGGTAAATAAGGACGA        ACCAACCACGAGGCGATGTA
  umc1715      1.09                 AW562781 
TTCATTGGGTCTCTAGCCAAGAAG        GGGGAGTCACAGATCTCATCAACT
  umc1726      1.10                 AF123535 
GATGAGGAAGAAAAGGGAAAAGGA        AGACTCAACCCTAACCCTAATGGG
  umc1737      1.10                 AW498363 
ATGCTTCTCTTCAGAAGCCATCC         TAGCTAGGTAGTGATGTGCGTGCT
  umc1774      1.10                 A85269 
ATGGGACTATGCATGGTATTTTGG        TACACCATACGTCACCAGGTTCAC
  umc1744      1.11                 AW519952 
ATGAAGCTGGCTGATACGGAAT          CGAGCCCTTAATTAGTTCTCGGTT
  umc1725      1.12                 AW600661 
CTACGGCCAGAGTATCGGTCAC          TATGGTGGGAGAGACGACAGGTAT
  umc1797      1.12 
TCAAGTGAAATGCATAGCTTGCTC        ACTGTTGGTAAACCCTGCATGACT
  umc1756      2.02                 AW438392 
ATCTCAGGTACTCTGCCTACGGG         AACAGAGGGTAGCTTGTGGCCT
  umc1776      2.03                 AF205806 
AAGGCTCGTGGCATACCTGTAGT         GCTGTACGTACGGGTGCAATG
  umc1783      2.04                 AW574496 
ATTCATTCAGGTCGAACAAAGTGG        GCTAGCTCGTCCACAATAAATGCT
  umc1749      2.06                 AW499261 
CTTCATTTTTGTTGTTTCCCTGCT        CGTAAAAGACTGGATTGCCAAAAG
  umc1763      2.06                 AW331727 
TCTGCTGTCAAGGGATCGATTATT        GGCAAGAGGTTTCTCACTGATGAT
  umc1806      2.06 
ATAAAGGTACCGTAGGGGGCTGA         GAGAGCAAGAGGGAGAGAGCAAG
  umc1745      2.08                 AW506921 
GGCACTTACAACTTCTTGCCTTCTT       GCCGTCAAGCGATGATCAAG
  umc1798      2.08 
TATAACAACGTAGCAAAGCACGGG        GATCGACCCTAATCGTCCTCCTAC
  umc1704      2.09                               TC13009 
TTCACCGGGTAGTCCTTCTTACTG        AAGTACGCTGTACGCAGGCAG
  umc1736      2.09                 AW461040 
CCATCCACCACTAGAAAGAGAGGA        TTAATCGATCGAGAGGTGCTTTTC
  umc1696      2.10                               TC16256 
CTAGGGTTTAACCAACGGGGAG          TAAGGAGAGGGTCGATGAACACAT
  umc1746      3.00                 AW506844 
ACACGAGCATCCTACATCCTCCTA        ACCTTGCCTGTCCTTCTTTCTCTT
  umc1780      3.00                 AW360685 
CTGTCCCCAGGTTGCTGTAGTAGT        CATGATGTACCCGCAACAAATG
  umc1793      3.00                 AW360685 
TGCACACCCTTTATTGAATCATCA        CGTATAAGCTTTTTGGGGTCCTCT
  umc1655      3.04 
ACGCAAGTACAAAATTACTGCGGA        ATTAACGGCATGCTTGTAGCCTAA
  umc1683      3.04 
CGTCCGAAACTGTCTCTTCCTC          GCCTCTTCTATGGAGAGACTGGAG
  umc1717      3.04                 AW573521 
ACGACGAATTCACTAACACAACGA        TTATCAGAGGAAGGGTTACGTTGG
  umc1721      3.04                               TC18514 
CTGCTCCACCTTTCTGGTCC            GTCATCTGGCCGACCTTCTC
  umc1729      3.04                               TC18473 
GTCGTACCACACCAGCCACA            TTCACTTCCACTTGTTGAACTTGC
  umc1742      3.04                 AW257824 
GCTTCCATCCTACTGATGATGGTT        AAGCTGATGCTTTGCCCTTG
  umc1772      3.04                 AW330577 
ACATAATAACAAGCAGGCAGGAGG        AAATAACGACTACGGTCACACGGT
  umc1773      3.04                 AW324744 
GGATCACACTATCGAGTCAGCGAT        CAAGGTAGCGTCGTCCTCCTC
  umc1750      3.04- 3.05           AW499191 
CCACAACTCGCTGCTGTCAATA          AGGAGGCTGCTGACCCTTCTACT
  umc1693      3.05                               TC15396 
CTTCGTCTTCCTCCACAAAACCTA        TGGTGATGCAGTAGTCGAGGC
  umc1730      3.05- 3.06           AW573320 
GCGCTGCCAACTGTATCTTTATCT        AAGTTACTCACGGTGCAGAGTTCC
  umc1690      3.07                               TC14774 
ACCTTAGTTACACAGGCACACGGT        GGTGATGGGATTTTCGCATTATTA
  umc1767      3.07                 AW330738 
GTGGCATTTTTATCTGCAACACAG        TGTAACTTAATCGTGGGCAGAACC
  umc1682      4.01                               TC12970 
AGCAAGCAAGCAAGTCACTGAGTA        GAGCTAGCCGGAGATAGAGAGGAG
  umc1757      4.01                 AW438120 
TTTTCTGCAGGGATAACATTTGTG        ATAGGAGGTGAGGTGAGGAGGAAG
  umc1758      4.01                 AW438120 
CTTCCTCCTCACCTCACCTCCTAT        GGTAGCCAATCCTTCCTTCCTATG
  umc1759      4.01                 AW438120 
GTGAGGAGAGGAGACGGAGAGAG         GAAGCTCCTGTGGAACGTGTG
  umc1702      4.05 
ACGAGGCTCTTCCGAGTTCC            GTTTGAGGTGTTCACGGGTTCT
  umc1791      4.05                 AW499383 
TCGTCAGTTTATTACTGCGACGAC        ATTCAGAAGACGGCAAGCTGATAG
  umc1775      4.07- 4.08           A85077 
GAGGACAACGCTGCTATTCTCG          GGAACTCCGTCAAAATCCCATC
  umc1808      4.08 
ATACACAGTGACAATGCGCCAC          AGCGAGTCATCAACATCATCAGG
  umc1740      4.09                 AW461073 
TACGGCTCAATTCCAGGAAAATAA        ATTGTGCTTGCCTGCTAGAGTACC
  umc1803      4.09 
TGACCTCTCCCTCTAGGCCTCTAC        CCCAATCTTCAGGTAATCCTCTCTC
  umc1699      4.10                               TC13032 
CTTTTGCTCAAACACGGGAAATAC        AGGCATTGAGCGATATGTTTGTTT
  umc1720      4.10                 AW520123 
TATTGCCGATTAATCTGTCCCATT        CAAGTTTGGGTACCTGAAGATTCG
  umc1738      4.10                 AW453330 
CCAGACATTCCCCAAACCCTA           CGTCGGTGTCGTACTGGTTG
  umc1719      4.10- 4.11           AW600623 
CCTGGAAGCACCACTGATACTAGC        AGCTCCAGCCTGCCTACCAG
  umc1649      4.11 
GTGAAGCTCGATTTCTCCTCACAT        CAGCGACACCATGATAAGTACACC
  umc1707      4.11                 AW600423 
GTCGAGAAGCGATCGATCATAGTAG       GCACGACAGGGAGTACGGTC
  umc1679      5.01                 AW258131 
CACTGCTAAGCTGCTCCCTGTT          TGCTAACTAACCCTGACCCTCTCA
  umc1766      5.01                 AW330795 
ACAAGAAGGAATCGAGAGCAAATG        CTTCGGGATGGAGTCGTAGTTC
  umc1781      5.01                 AW267325 
CAAAAGGTGCAACTGTAATTGCCT        ATGAGGCGAAGCCAAGAAAAAGT
  umc1761      5.02- 5.03           AW355888 
GGCTTGTAGTTGGAGTGGTCGTAG        AGCAGCTTCAGAGGAGGAAGAAG
  umc1686      5.03 
GGTGAGGTCGTACCGGAAGAG           GCAGCATCTTCTTTGTCGGC
  umc1692      5.03                               TC12816 
AGAGACGAACTGAAGCCTGAAGTG        GATGTCCACGTCCTGGTAGAAGTT
  umc1705      5.03                               TC15658 
ATCTCACGTACGGTAATGCAGACA        CATGACCTGATAAACCCTCCTCTC
  umc1731      5.03                 AW563115 
TATTGACGATAATGTTCCCGCTTT        GGTTATAGGATGACGAGACGGTTG
  umc1784      5.03                 AW519828 
CCAAGGTCGTCATAGCCAACA           CATGCACACGTTTGGTTTCTTAAC
  umc1747      5.04                 AW506691 
ATCCGCTATCGAATGGCAGC            GAAGAAGGAGATCGAGCGGCTA
  umc1687      5.05 
TGGGAAAGGTGAGAATATGTGTTTG       GCTGACGACAAATATTCGAGAACAA
  umc1722      5.05                 AW600643 
ATGCATGCCTTGATAATGGAGAAC        ACTCTCTTCCTTCTCCGTGCTTTT
  umc1800      5.05 
TTATGGGTGCTGGTGATGTGTATC        GAAAAGCAATCGCTTCTGAGAAAA
  umc1752      5.06                 AW461037 
ATCCTCCTCCATATTCTATCGCGT        GAAACAGAGCAGGAACCGGAG
  umc1792      5.08                 AW498199 
CATGGGACAGCAAGAGACACAG          ACCTTCATCACCTGCAACTACGAC
  umc1753      6.01                 AW461145 
AAGATCTTGCTCCGTTTCCTCTCT        TTCAGATGCAAATCTCTTTTCGCT
  umc1723      6.02                 AW574483 
GAAAACTAATCAAACGCAACCAGG        GATGGAGTGAGGATTAGCAGCCTA
  umc1796      6.02- 6.03           AW562820 
CGCTGAGGCTTAAGATGGTGTT          AACGCCTTTACGAGCACGAAC
  umc1795      6.04- 6.05           AW330572 
CCCTCTCTTCCTAGGTTCATCGTT        CAGCGGCGTCTTGAAGAGTAG
  umc1751      6.05                 AW498335 
CCTCATAAAACCAGCAGATCCCT         GCTTTTGTGTATACTGGTTTCGCC
  umc1805      6.05 
AGTGCACCAGCTTTTAATCACCTC        TGTGACCTGTGTGGTCTGTGG
  umc1762      6.06                 AW352633 
CTTACTCCAGGCACTCCATACCAT        ATCCAGGTGAATGGTGTTTACGAT
  umc1779      6.07                 AW424482 
AGGAGTACGGTCGGCACGTT            GCTGCTGCTGGTTGTGATAGC
  umc1695      7.00                               TC12153 
CAGGTAATAACGACGCAGCAGAA         GTCCTAGGTTACATGCGTTGCTCT
  umc1788      7.00                 AW267378 
CACTAATTGCTACCAGGAGATTCAAA      AAGTCAGTGAAGCGCTGAGTTTTT
  umc1787      7.02                 AW282410 
TGTAGTCCATGGAGCTCTTCTCCT        CTTTTTCACACTCTGCACCTCCTC
  umc1718      7.03                 AW566142 
TGAAGGACATACACCAATCCTCAA        ACTAGTAAGGTGCATTTCCAACGC
  umc1684      7.03- 7.04 
GAGCTAGCTTTTTGCTTTGCTCAC        AAGGGGCCCAGGTACTTGAC
  umc1708      7.04                 AW585300 
GATATGTCGAGCTTCGCTGGAG          CGCACACTAAAGCATCCTTAACCT
  umc1710      7.04                 AW563194 
ACTTTGCAACTACCGTACATGGGT        TTCGACTGCACGTGAAAATCTATC
  umc1768      7.04                 AW330690 
ATTCCATTTCCCGGAGCCTACTA         CAGAGCACACACTCACGAGTCAC
  umc1782      7.04                 AF233881 
CGTCAACTACCTGGCGAAGAA           TCGCATACCATGATCACTAGCTTC
  umc1799      7.05- 7.06 
GTGATGAATAATGTCCCCAATTCC        GGACAGATGTCTGGAGATTGCTTT
  umc1786      8.00                 AW288952 
ACCGTGACTTCCTCCTCATAACTG        CATTTTTCGCATTTAGGAAATCCA
  umc1790      8.02                 AW257980 
GAGAGGGAGGAGCAAGGAAATAGA        GAGAAGAGTTCTCCATGGAACGAG
  umc1778      8.02- 8.03           AW424513 
GTGAACCATTGTAGCTGTCCCTG         GAGCTCGTACCTGTTCATGAGGAT
  umc1741      8.03- 8.04           AW424565 
AGACGAACCCACCATCATCTTTC         CGCTTGGCATCTCCATGTATATCT
  umc1802      8.03- 8.05 
TTCCTGACAAGAAAAATATAACAGTGG     TTTCACAGTAGTGTCAGAAAGAGTTCA
  umc1735      8.04                 AW585263 
GCGCACAATATAATGAACCAACAG        TTTGCCAAAAAGACATGACACCTA
  umc1712      8.05                 AW585307 
TACCTACCTTTTGATGCAGGTTGC        CGGCACTAGTGAGTCTGATCAATG
  umc1765      8.05                 AW331078 
AGATCGTGAGGACCATCAGCAG          GAGAGATCCATCGTCAGTCGTAGC
  umc1777      8.05                               TC13887 
GACAGCACCTGAAACTGAAACTGA        GTCTTTCTCCACATCCCTGTTTGT
  umc1728      8.05- 8.06           AW573317 
AGTACTTTCAGGCAGGGACCTTCT        AACGCACTTCTTGTAGCTGTAGGG
  umc1724      8.06                 AW520143 
GTCTCAAGTGAAACAACCACGCTT        CCACATGAGATGAGATTGCCATT
  umc1764      9.02                 AW331221 
AATAAGCATGCTGCTACTGTCGTG        ACGCATACACTTCCTTATTGGCAT
  umc1688      9.03                               TC12180 
AGCAGTAGCCGCAAGCAGAG            ATCTGGAGCTGCGTGCTGTC
  umc1691      9.03                               TC12180 
TCGTCTAAACTGCATAAAAGGGGA        ACGGAGATAGATGCACACAAACAC
  umc1771      9.03- 9.04           AW330595 
CATCAGGAAGGAAGACGACTAGGA        GTGAAATGTTGTTTCCAATGCAAG
  umc1732      9.05                 AW562406 
GAATTACCTGTTTGGAGCGGAAG         GATTTTCTCTGTAGTTCGAGGCTGG
  umc1794      9.05                 AW330874 
AGAGTAGATGCCGTGTAAGCAACC        CGACCGGGGTAGTGTAGTGATAAG
  umc1733      9.06                 AF236080 
ACACCCAACCTCCCACTGTAAAA         GATTGGGATTGGGATTGGAAAT
  umc1804      9.06- 9.07 
GCGGCGAGGTTAAAGGAAAA            GGTGTTTAGACACGCAGACACAAC
  umc1785     10.03                 AW400188 
TTCAATCCGTAGGTCTGGTGCTAT        CAATAATTTCTTTCGCCTTGTTCG
  umc1645     10.07 
CATCGTCATCAGTTCTTCCATGAG        GTGATTGACAGAGGACCATCAGAA







More information about the Maize mailing list