SSR update

Mary Polacco maryp at teosinte.agron.missouri.edu
Thu Jan 11 13:05:27 EST 2001


The Missouri Maize Project has kindly provided 53 new SSR primers
and map locations to MaizeDB. In addition, they have supplied more
precise bin locations for some 193 previously mapped SSR. In 3 instances,
SSRs are now located differently than the original assignments:
   umc1256, previously 1.00-1.01     now 2.09
   umc1483, previously 1.01          now 8.01
   umc1817, previously 2.00-2.02     now bin 8.0

Data, with details are accessible at the SSR page:
     http://www.agron.missouri.edu/ssr.html

Noteworthy Comment: of the 816 public SSR mined from sequences in GenBank, 590
are from cDNAs, and of these, 532 were generated by the Stanford EST
project. 

TWO SUMMARY TABLES WITH THE NEW DATA FOLLOW. 

Cheers,
  mary

Mary Polacco, PhD 
USDA-ARS Plant Genetics Research Unit
Geneticist & Curator, Maize Genome Database - MaizeDB
Adjunct Assoc Prof,  Dept Agronomy
University of Missouri, Columbia, MO 65211
+1 573 884 7873 (phone)
+1 573 884 7850 (fax)
http://www.agron.missouri.edu/ars_columbia/polacco.html


FILE 1: New, mapped SSR primers.

SSR            Bins                  GenBank               PrimerF                         PrimerR                        
 ----------  --------------------  --------------------  ------------------------------  ------------------------------ 
 umc2025      1.05                                       CGCCGTAGTATTTGGTAGCAGAAG        TCTACCGCTCCTTCGTCCAGTA         
 umc2029      1.08                                       AGAGCAATCCTGTTCCAAATGAAG        CTTAAACCCAATCGAACTCGAACA       
 umc2028      1.09                                       ACGAGTCACGAATCCGGATAGA          GATTGTCGTCATGCTTCCTTCTCT       
 umc2047      1.09                                       GACAGACATTCCTCGCTACCTGAT        CTGCTAGCTACCAAACATTCCGAT       
 umc2045      1.11                                       AGAACACAGCACCACCTCCTTG          GTACCGGAAGAAGAGACGGGAG         
 umc2030      2.04                                       CTTCAGCAACCGGAGACGAG            GATGCAGTGTGCCAATAAAGATGA       
 umc2032      2.04                                       TCTATCATTCGAGTCAAGAAGCCA        AAAAGAAGACGGATTTCTTCGGAC       
 umc2023      2.06                                       TCAGTCCCATTATATTCACCGACC        TCCTCTTCTTTTCCTCTCAGAGCC       
 umc2019      2.07                                       GACATGGACTGCCTTCAAATGAT         ATAGCTTTTCTCAGTAAGCGCCAG       
 umc2049      3.01                                       CCAGGTAGTTACTTTGCTGCTGCT        GAGAGATGTAGAGAAACCGACCGA       
 umc2024      3.04                                       CTTTGGAGGCGCAAGAAACAG           AAGAAGCCAGAAAGTCTGGTCCC        
 umc2033      3.04                                       TCTAGATCCCTAGAGTAGCTGCGG        CACTCACGCAAATTAGCACAACTT       
 umc2020      3.05                                       TTTGGAGTTATGGTTTGCGTTTTT        TGATAACGCTGAGAACGATGAAGA       
 umc2050      3.07                                       CTCCTGCTGTGATTCTAGGACGA         CTGGATCTCGGCATGGTCTT           
 umc2048      3.10                                       GCTGAAGTCCCAACCACCAC            TTGACATGTTCTACCATCTCACCAA      
 umc2039      4.03                                       CATCTCCTACCAGCTCACCCC           GCTCGGGGTAGTAGTGTTCTCCTT       
 umc2054      4.05                                       CATTTCCTTCCCTGCTCTGATG          TACAGATACTGGAGCACTCTCGGC       
 umc2061      4.05                                       GTCTGGAGAACTCCCTACCCATTC        TAGCTTGAGAGACCGGAACAGC         
 umc2027      4.06                                       CAAATATCTTCGCAGCTCCAAATC        GTACCTGTCTTTGGGGCTTTTCTT       
 umc2038      4.06- 4.07                                 ACAGAAACCAATGCATGTGATGAG        TGCATGGTTGCTTCAGCAGT           
 umc2070      4.06                                       ACCTCTACGATCTCTCCGACGACT        TCACACGCTCCTTCTCATATACCA       
 umc2041      4.08                                       CTACACAAGCATAGAGGCCTGGAG        CAGTACGAGACGATGGAGGACAT        
 umc2046      4.09                                       CGTTCACCTCTGCCTTTTGTTC          GAAGGATCCGACGAAGACCTG          
 umc2044      4.10                                       ACCTCTCTCCGCCGAAGAATC           CATATAGGTCATGCCTGCCATCTC       
 umc2022      5.00                                       TTAGTCTAACCGAGTCCAACCAGTG       ACCAGCAGACGGAGAGCTTG           
 umc2036      5.01                                       TCAATCAAGCCTCTCGTAAGGAAC        CTCTTGATCTCAACCGAAATCCTG       
 umc2035      5.03                                       ACCACAACTACTACGGCCGAAAC         ACTGTTGCTGGTACGAAGAGTTCC       
 umc2060      5.03                                       CCAATAATACCATTCTCCCCAGC         GGGTTCCAGCAGTGAGTGACA          
 umc2063      5.03                 AF099426              GGACTGAAGCGTGGAATGTTCT          ATCGCAATCTGAGACCACTTGTT        
 umc2066      5.04                                       ACATGGGCCGATGACTAAGAATAG        CTGAGTACACACATGTCACACAGTTG     
 umc2026      5.05                                       TTCGACATAGCAGACGAAACTCTG        ACTGCACCCTAGTGTGATGTTCCT       
 umc2058      5.06                                       ACGACGAGACTCTGTTCTGGTTCT        AGGAGGATTACGTCAATCTGTTCG       
 umc2068      6.00                                       CCGCTCCTTCTCCTCCTCATC           GGAACTCCTCGAGCGTGAGC           
 umc2056      6.01                                       GCATTAGCAAACAAAGTGGGTTTC        GGCGAAACTGTGATGAGAAAACAT       
 umc2040      6.05                                       GAGACACAGGAACAGAACCCTCTC        GAGACATCTCGACACCTCTTGTGA       
 umc2055      6.05                                       CTTGGCTGCTTGCCCTATTAGAT         CTCTGGTCTGGTGGTCCTGTG          
 umc2065      6.05                 AW289047              CAAGGTTCGGTCCTTCTTCTCC          GACACCTCGTCGTCGGTCAC           
 umc2059      6.08                                       GGAAAAGGAGGAACAGTGTAAGCA        AGCGTGATCAGACGTACAATGCTA       
 umc2057      7.02                                       CCATCCGTAACACTTAAGGACGAC        TCATGAAGCTCCAGCAGTATCTGT       
 umc2062      7.04                 AI855336              CATGATCATCCTTAGCGACTCCTC        CATCGAGCTCAAGGAGCAGGT          
 umc2042      8.01                                       GCAGTCTCTCCACTACCAGAGCAT        AACAGAGGAGTACGAGGAGGAGC        
 umc2031      8.06                                       TGAGGATCCAGGGGTTCGAC            ACAAGGTTCTTCCTCCTCCCTCTT       
 umc2037      8.06                                       TTCGCATTACTACGTTTGGTTCCT        CCCACAGGACTGGTGTATCTGA         
 umc2052      8.08                                       GTACCCAACAAGCCCTACACCTCT        CTTCCTCACGCCCCTGTAGTG          
 umc2018     10.01                                       TAGCCAAGCTTCTCCCTAGCTTTT        GCAGTTGGAGGAGGAGCAGAC          
 umc2053     10.01                                       ATCTCTCCCTCGCTCTCCTTCTC         AGCAGCAGGTTGGTCGAATG           
 umc2034     10.02                                       TATCTCCTCCGATCCTAACACCCT        GCTCATACGGAGGGTCAGCTAAG        
 umc2069     10.02                                       ACAACCTCCTCCACGACCAAAC          GTAGAGGTCCCACTTGTTCCCAAT       
 umc2016     10.03                                       AGAGACGACATGTCTATCCTTGCC        ATTGCATTGCATTCAGCTGTTGT        
 umc2017     10.03                                       AGAGGTTACTACGGAGTGTGGCAG        GTCAGGGTACTGCTTCTCGAACTC       
 umc2067     10.03                                       ACGATAAGTCTGGAAAGATCGTCG        GATCTCTCGCACCACCTGTATGTA       
 umc2043     10.05                                       GAGGCATACGGCATACCATACC          GTAGGAGAAACAGGTGCTGGTGTC       
 umc2021     10.07                                       AAACTCAAGCTCGGAATGTACTGC        CGATACTGATCTACTTCACGCTGG       

////


FILE 2. Bin refinements of previously mapped SSRs.

  

 SSR         Bins                  GenBank               PrimerF                         PrimerR                        
 ----------  --------------------  --------------------  ------------------------------  ------------------------------ 
 umc1160      1.01                 AI586523              CGTTTGATATGATGTGGAGATTCG        AAGCTTGTGAATGTTCTGGATGTC       
 umc1177      1.01                 AI001344              CGTGTACCGCTCCTCTATAGTCGT        AAGTGGCCGAATTCATCCTTTATT       
 umc1297      1.05                 AI947917              TGGTCACTGACTGTTTCGACTAGC        ATCGCCTCAACACACCTTCATATT       
 umc1676      1.05                                       AGTCGTACGATGACGGAGGC            GCACCACCGACTGATCAAGA           
 umc1122      1.06                 AI691437              CACAACTCCATCAGAGGACAGAGA        CTGCTACGACATACGCAAGGC          
 umc1668      1.06                                       AGCAAATAAAAGTAGAGCGGCGAG        ACCACCACCACTGCCTCCTC           
 umc1812      1.06                 AW520058              TACAAGGAAGGCAAGTTCATCCTC        ATGCAGGTGACATTCATCATCATC       
 umc1972      1.06                 BE051243              ATAGCTCGAGTATTGCGTTGCTCT        AGTTGTTGGTGATGGTGAAGGTG        
 umc1358      1.07                 AI855272              AGAACCTCCCGCTTGACGAC            ACCTCAACCTCGACCTCTGCAT         
 umc1374      1.07                 AI881349              CTACTCCAGCAGTTCCGCTCC           TTCAGATGGTGTAGTGTGGAGAGC       
 umc1661      1.07                                       ACGAGACTCCCTCCTCTCCTCTC         GGAGTAAACTGTTGAAAGGCCCAT       
 umc1245      1.08                 AW011644              TGGTTATGTGCATGATTTTTCCTG        CATGCGTCTGATCTTCAGAATGTT       
 umc1184      1.09                 U13702                CTTCCTTACGTGTCACCGCTCT          GTGGAGTGATGTGATCGATGATG        
 umc1914      1.09                                       CAACATGAGCGTGCTAAATACTCG        ACAGGAACACATGAGGTCATCAAA       
 umc1431      1.10                 AI738206              GTTGCTGTCCCCGACGTAGTAG          GTGAGAGTACCGAGATGGCTGAG        
 umc1331      1.11                 AI881368              TTATGAACGTGGTCGTGACTATGG        ATATCTGTCCCTCTCCCACCATC        
 umc1630      1.11                                       CAGACCTTCGAGGGCAAGAACT          AGTTTTGGCTTCTTCTCCCAAGTC       
 umc1165      2.01                 AI491254              TATCTTCAGACCCAAACATCGTCC        GTCGATTGATTTCCCGATGTTAAA       
 umc1227      2.01                 G54896                CAAGTTGGTGAGATGGATCTGTTG        GCTCCTGGGTCTTCCTCTCC           
 umc1518      2.02                 AQ844799              TAGCTCCTTTGCGCTATTCAGTCT        GGCAGTGTTTTCTTTTGAAGTGCT       
 umc1552      2.02                 AW067031              CTCGATAGCTCTGCTGCTTCCTC         CAACACCAGCCCTACCCAGA           
 umc1185      2.03- 2.04           U13701                AGTAAAAGAGGCAAGGACTACGGC        GCGGCGATATATACGAGGTTGT         
 umc1555      2.03                 AW066809              ATAAAACGAACGACTCTCTCACCG        ATATGTCTGACGAGCTTCGACACC       
 umc1026      2.04                 G42324                TCGTCGTCTCCAATCATACGTG          GCTACACGATACCATGGCGTTT         
 umc1485      2.04                 AI734331              CAATACCATTACATACCCGCACAA        CCGGCCGTTTAATTTACTAGTGTG       
 umc1579      2.04                 AW057010              AAGATCAGCTAGCGAGAGAAGCAA        AGGAGGTCAGTGCTGCAGGT           
 umc1635      2.05                                       GCTGAGCAGATCTTTCCTTGTTTC        AAGGAGCAGAACTCGGAGACG          
 umc1065      2.06                 U82230                ACAAGGCCATCATGAAGAGCAGTA        CACGGTCTGGCACACTAACCTTAT       
 umc1079      2.06                 G44735                AGCACACATGCACAACATCTTACA        CGTTGGGCCATGACTTTCTTTA         
 umc1080      2.06                 G44737                GAGGAGAAAAGGAGATGGAAAAGC        AGATGCCGCAGAAGATTCTAAACA       
 umc1658      2.06                                       AGAGATGGGGTAGAAATAGACGGC        CTCTCTGCTTTCTCTTCTCTTGCG       
 umc1923      2.06                                       GTGATGGAAGAAGGGCTACAGATT        GGTATAGTATGGTCCGACACGGTT       
 umc1042      2.07                 G44696                AAGGCACTGCTACTCCTATGGCTA        CTGACCTTTGAATTCTGTGCTCCT       
 umc1554      2.07                 AW066844              TCTTCTAGAATCCAAAGGCACAGC        GTAGCAGCAACTTGCAGGTGATAG       
 umc1560      2.07                 AW066244              CGTTCGTCTCTGGGTAGCGTAG          TATAACAGCCTGCTGCTGCTTG         
 umc1637      2.07                                       GTTCCAGTTCAGCTTCCAGCA           CTGTCGTGTACAGCATCACTTCTG       
 umc1230      2.09                 G54898                GCGATTTCAACTATTTGTGGTAAAGG      GTACGACCGTTGAAACTGTTGTTTT      
 umc1256      2.09                 AI987546              CATCTCGACCTTTGACATTCTCCT        AGAAGACGATGATGATGATGCAGA       
 umc1551      2.09                 AW067107              CACCGGAACACCTTCTTACAGTTT        CGAAACCTTCTCGTGATGAGC          
 umc1780      3.01                 AW360685              CTGTCCCCAGGTTGCTGTAGTAGT        CATGATGTACCCGCAACAAATG         
 umc1300      3.05                 AI947741              TCTGAACGCACTGGGAACATAGTA        AGAATAATGGACGGTTCCTCTGG        
 umc1307      3.05                 AI943906              GTACGGGTGAAGAGAACAGGTCAA        ATCTTCTCTGTTTTGGTCCCTTCC       
 umc1286      3.06- 3.07           AI987404              ACCGGACCGGATCTTTATCTTTTA        GAGGTTATTTCTCCGCAACTCGAT       
 umc1400      3.06                 AI795298              TTACCAATTGTATCCATCACACCG        ACAACATAGCAGCCATCCTACTCG       
 umc1644      3.06                                       CCATAAACTGTTCCTTTGGCACAC        CTTTCACGTGTTAAGGGAGACACC       
 umc1674      3.06                                       ACGAGGTCCACGACTATGGATCTT        AGTAGTACACGGCTGACGGCAC         
 umc1730      3.06                 AW573320              GCGCTGCCAACTGTATCTTTATCT        AAGTTACTCACGGTGCAGAGTTCC       
 umc1659      3.07                                       CAAGCTTGCTACTGTGATTTCTCG        AACTTCTCGGTGATCTTGTCCATC       
 umc1825      3.07                                       ACTCAAGAGCAGACTGCAAAACCT        CGTGCATGTATTGTTTGTCCTAGC       
 umc1273      3.08                 AI948095              GTTCGCTGCTGCTTCTTATATGCT        AATTGGCGCAGGCTATAGACATTT       
 umc1052      3.09                 AI372100              GTGTACAACACCAGCAACAGCTTC        GTAGCTCCCCATCTTGTCGAAC         
 umc1639      3.09                                       CTAGCCAGCCCCCATTCTTC            GCAAGGAGTAGGGAGGACGTG          
 umc1669      4.01                                       ACGAGGGCTTCTTCTCTGAGC           GTTTCCTTCTTCATGCGACGAC         
 umc1294      4.02                 AI948003              GCCGTCAACGGGCTTAAACT            GCCTCCAGCTCTCTCGTCTCTT         
 umc1509      4.02                 AW172105              CTTTCTGCAGATTCACCGTTTCTT        TTGGTTCTTTTGACCATAGACAAGC      
 umc1117      4.04                 AI691779              AATTCTAGTCCTGGGTCGGAACTC        CGTGGCCGTGGAGTCTACTACT         
 umc1390      4.04- 4.05           AI833614              CCTCGAAACAGATGCCTGAGTC          AAATGATCCCGAAGCCTGAGAC         
 umc1652      4.04                                       GAGAGCAGTAGCACTGACCCTTTC        CACTCGACCTCGATCGGAAC           
 umc1088      4.05                 G44744                TCATCCTCCTAGCTCCTCTACTCG        AAAACAGTCAGCAGAACCCACTTT       
 umc1142      4.05                 AI649544              CCGAAAACCCATTCTTCTAGCATC        GTGCGGTGTTCTCTCTTTCACTCT       
 umc1317      4.05                 AI920379              GCTAATGTTGCCTGTTGGCATAG         CCGACTCCGAGTAGCTTTCGT          
 umc1346      4.05                 AI881378              TCTGATCTCTTCGGTGCTAGAGAAA       AAGAGATCTCCCAACCCTAACTGC       
 umc1382      4.05                 AI948008              AAGAAAACAGGTAACGGGCATGTA        TGGAATTCTTCTGACTACCCCAAG       
 umc1662      4.05                                       CCTTCTTCCTTCACGCCTCTTT          GACCACCTCATCTCTGACTCTGG        
 umc1945      4.05                                       GCGTACTGCTGGTGGTGATG            TGGGACCCCTAACTACTACGGC         
 umc1953      4.05                 BE186707              AAGCAGAAGCGAGACACTAACACA        GATCGATCGACGATTATGGATCTC       
 umc1964      4.05                 BE056946              CTTCTCACTGTCGCAGAACAAGAG        CCGTATGTGTGTACTGTGGATTCAT      
 umc1969      4.05                 BE051731              CTCGAGCCCAGCAGAGAAAG            GGTGGAGCCCATGGCTATTACTAT       
 umc1651      4.07                                       GATGGTGGTTATGAATGCATGTGT        AGACGACGAAATTAACCAGCCATA       
 umc1466      4.08                 AF069911              CGAATAGTGGTCTCGCGTCTATCT        GATCCACTAGGGTTTCGGGGT          
 umc1476      4.08                 AI770848              CTCTGCCTCAGTCTGGTCGC            CGAGGAAAGGAAGGAGAGCG           
 umc1775      4.08                 A85077                GAGGACAACGCTGCTATTCTCG          GGAACTCCGTCAAAATCCCATC         
 umc1101      4.09                 AI715011              GCTGAAAAACGGAGTTCATATGGT        AAGCTTATCCACCTCGAGGAAAAC       
 umc1574      4.09                 AJ011615              TTTCATGTGCTTGCAGAGTTTGAC        GTCATGCAAGTATCCGCTGTCTT        
 umc1623      4.09                 AJ011615              TCCAGCAGAACACCAACCTATTAGA       GAGACCAGCAGGTAGTTCTTGGAA       
 umc1631      4.09                                       CATGAATAAAGATGGATGCTGGTG        GGAAAAACAAAGAAGCATAGTAGACAGC   
 umc1643      4.09                                       ATCACCACATCCGTTGCAAAT           CTAGAATCTCGTAGAGGCTCCTGC       
 umc1940      4.09                                       AACAACAAATGGGATCTCCGTTAC        CCATCTGCTGAGGGCTTATCTG         
 umc1999      4.09                                       GTCCCATCTGCTGAGGGCTTAT          ACAACAAATGGGATCTCCGTTACA       
 umc1503      4.10                 AW215967              TTCATGACACACAAACCACAGATG        GCACCCTAGCAGACTACAACATCC       
 umc1050      4.11                 AI374559              CGATACACATCCATCTTCAGGTAGC       GCCTTTGTACCAATACAAGCCAAG       
 umc1610      4.11                 AW244910              CTTGAGATCTGTGGCGTCGTC           CGTCTCCTCCATCTCTACTCGTTC       
 umc1719      4.11                 AW600623              CCTGGAAGCACCACTGATACTAGC        AGCTCCAGCCTGCCTACCAG           
 umc1163      5.00                 AF105716              AACTAGAGGACACGCAGACTTGCT        GTTCTGCAGGGAAGAAGCAGC          
 umc1761      5.02                 AW355888              GGCTTGTAGTTGGAGTGGTCGTAG        AGCAGCTTCAGAGGAGGAAGAAG        
 umc1056      5.03                 AF037031              CGGATCGCTTTTTACCGTCTATAA        AGCAAGAGTAGCGTTCCATTTCAG       
 umc1151      5.03                 AI612267              GATCCATAGCGCTAGTGCACTCTT        ACTGCCGGGTGGCTAATGAT           
 umc1373      5.03                 AI881480              ATGATGATGACGACGACGAAGAT         CGTCAGGTCTGTTGCATATCTGTT       
 umc1482      5.04                 AI739789              GAACAAAGAATCACAACACGATGC        CAGGTTCTGAGGAAAGCAAGGTT        
 umc1575      5.04                 AJ011614              GCCTAGACGTCATGGACAACG           GAGTCGAGACTGCCGTCCTTC          
 umc1629      5.04                                       GCTCCAAGTtcgtcgtcgtc            CTCACGACCTTCTTCTTGCACAC        
 umc1815      5.04                 AW424827              ACATACAGGTCACAACTCACAGCG        GCTGCCTTCTTCCTTCTCTTCTCT       
 umc1019      5.06                 G10810                CCAGCCATGTCTTCTCGTTCTT          AAACAAAGCACCATCAATTCGG         
 umc1375      5.07                 AI881341              AGTTCGACTTCGACCCGGAC            GTCAGGCTTCTTCTCGACACACC        
 umc1646      5.07                                       GCAATTATGAACAGTTGCGTGTGT        AGTGGATCGATCGAACATGACTTT       
 umc2013      5.07                                       GGGACGAGAGTCTGTTGTTGTTG         GTTGATGCATGTGACTCTGGAAAC       
 umc1829      5.09                                       GTTGATTGGTTGATGTGGAAACAA        CAGTTTGATGTTCATGGCTCTCTC       
 umc1883      6.00                                       GAATAATCAATCCATCGATCTCGC        AACTGCTGTGGATGAAAGAGGAAG       
 umc1996      6.00                 AW787579              CTCGTCGTGTTAGTCGTGAAGC          CAGAAGCTCATACGGGTTCTCCT        
 umc1186      6.02                 U10076                TCAAGAACATAATAGGAGGCCCAC        AGCCAGCTTGATCTTTAGCATTTG       
 umc1517      6.01                 AQ845168              TAACACTCGGAACCTTCCTTCTC         GATGGGAAAATGTGTGGAATTTAT       
 umc1832      6.01                                       GATGCTCGAATTTGTGATGAATGA        TGTGTACCAAACTTCATGGTGGTC       
 umc1083      6.02                 G44740                CTTTCCTCTCTGGAGCGTGTATTG        ATATGTTGCAGAACCATCCAGGTC       
 umc1178      6.02                 AF019146              CTGTCGTAAGAGCGCCAACAG           GTCTGAACGATGAACAGTACACGC       
 umc1628      6.02                                       GGCTGTAATGCAGGAGATTGAGTT        ACTCACGTCACAACTACCGTACCA       
 umc1656      6.02                                       AGTTTTGACCGCGCAAAAGTTA          GTACGAGCAGGCCATTAACCC          
 umc1614      6.04                 AW163864              GAGCTACTCAGCCAAGACGAAAAG        TCACTTGCATGAGCAACTTCAGTA       
 umc1796      6.04                 AW562820              CGCTGAGGCTTAAGATGGTGTT          AACGCCTTTACGAGCACGAAC          
 umc1918      6.04                                       CACAAGAACATTATGACGACCGAG        AAGCAGGAGACATCGTTTAAGTCG       
 umc1795      6.05                 AW330572              CCCTCTCTTCCTAGGTTCATCGTT        CAGCGGCGTCTTGAAGAGTAG          
 umc1341      6.05- 6.06           AF073330              GTCTACCAGGACGTTTACCTGTGG        CCTCAATCCTTTGTGGACAAACAC       
 umc1859      6.06                                       ATATACATGTGAGCTGGTTGCCCT        GCATGCTATTACCAATCTCCAGGT       
 umc1912      6.06                                       ACGAAGGTAGTCCATCAACTGCAC        GACGGGGGCTGTAGGTTCTG           
 umc1248      6.07                 AW000535              CTTTGTCCATCGGCTTTATTCTTT        CACATTAAGTTACAAATACAAATCACCG   
 umc1296      6.07                 AI947918              CTCTCCCGGCTCTGACCTAGC           GCTGGAGATAGGCATCCAGACAC        
 umc1621      6.07                 AW066892              AGACTCTGAGGAGGTAGACGCTGA        GACTCGGAGGCCTTCTACATGAT        
 umc1653      6.07                                       GAGACATGGCAGACTCACTGACA         GCCGCCCACGTACATCTATC           
 umc1127      6.08                 AI677270              GGTCCAGTGACATCTCAAAATGAA        ATATTCCCCCTCCCTAATTTTGCT       
 umc1426      7.00                 AI745774              TAGGGTCGATTCTGGATTGTCTG         TGTAAAACAGAAAGCATGCGAGTC       
 umc1480      7.00- 7.02           AI746088              AATGAAGGTGGATGTGCTGCTACT        CTTCCCCATCTCCTCTTGAAGATT       
 umc1642      7.00                                       CACTACAGCGCCTGTAACTGCC          CATGAGCTAAGCAAGAGGGGTATG       
 umc1672      7.00                                       CTTTGTTCCAGATCCATCTTTTCG        CCTAGACCCCACTCATGTGGTAAC       
 umc1694      7.00                                       ATCATTCTGCAGGTCACGAGAAG         AGAGACGAAAACCGACCATTCAT        
 umc1068      7.01                 G10755                AGTCGTTTTCAAAGGCTGCTGATA        TGAGTCACCTCATTTCTTCTGGTTC      
 umc1409      7.01                 AI770780              GCTAGTAGACATCGACGGATCGAC        ATGACGTCCAGGAGGATGACC          
 umc1428      7.02                 AI745868              CTATCTCGGTAACTCCCACCAAAG        GTTACTACCGTGATGAAACGAGGG       
 umc1549      7.02                 AW067361              ATTCACTCTTGCATTGCCTCTACC        ATGAACGAGTCCAGGAGTTTCTTG       
 umc1666      7.02                                       TTATTGCCCTCCCTGTTCTTGTT         ACCTTGACGCAGCAATCCTC           
 umc1927      7.02                                       AAGACAAATGGTTCTCTTCTATTGTTG     CGCCTAAAAAGCAAATGAGAGTTA       
 umc1932      7.02                                       ACTTGCGCATATAAGTCGGGATG         AGGATTAACGATGAGGAGCCTCTG       
 umc1015      7.03                                       CAGACACAAGCAGCAAAGCAAG          TCCGACTCCAAGAAGAGGAGAA         
 umc1112      7.03                 AI711634              TTGGGTTCAGTTTTCACAACCTTT        AAGATGATTACTAACTCGCGGCAG       
 umc1888      7.03                                       TCCAAAAATGTTTCTGCTGAATGT        TGCTTGAAAAATCTTGATCAGCTC       
 umc1936      7.03                                       GAGCTCATGTGTATGTGGACGTTG        AATAAACAGAGGTAGGTCAGGTCGC      
 umc1125      7.04                 AI677562              CGTCCGACATCTTGCTTTTCTATC        TTTTACTTCTCAGCGGTAGATCGG       
 umc1684      7.04                                       GAGCTAGCTTTTTGCTTTGCTCAC        AAGGGGCCCAGGTACTTGAC           
 umc1944      7.04                                       GAAGAAGGATCGCACACATGG           AGACTGTCGCGCTGTACTATACCC       
 umc2001      7.04                                       TGAAGAAGGATCCGCACACAT           AGACTGTCGCGCTGTACTATACCC       
 umc1671      7.05                                       AGCGGAGGAGAGGGAGGTTAT           AAGTCCAGGTACCTCAGCTTCG         
 umc1799      7.06                                       GTGATGAATAATGTCCCCAATTCC        GGACAGATGTCTGGAGATTGCTTT       
 umc1075      8.01                 AI396125              GAGAGATGACAGACACATCCTTGG        ACATTTATGATACCGGGAGTTGGA       
 umc1139      8.01                 AI665279              TTTGTAATATGGCGCTCGAAAACT        GAAGACGCCTCCAAGATGGATAC        
 umc1327      8.01                 AI881644              AGGGTTTTGCTCTTGGAATCTCTC        GAGGAAGGAGGAGGTCGTATCGT        
 umc1483      8.01                 AI737407              GTTAGGGGGTAGAAGACAGGGATG        GTTCAAGGCCATTGTAATCCTCCT       
 umc1592      8.01                                       GACCATATGTGCTCCAAAACCTTC        AAGCTTCTTCGGTCTTTGTAGGGT       
 umc1786      8.01                 AW288952              ACCGTGACTTCCTCCTCATAACTG        CATTTTTCGCATTTAGGAAATCCA       
 umc1817      8.02                 AW400071              CTACGCAGGCTTCAACCACC            GTACTGGTGATGATGGTACCCCTG       
 umc1868      8.02                                       CCATCATGGAGTTGCGGTTATTTA        CCCATAGAGTGCTTGAAATTGTTGA      
 umc1289      8.03                 AI979643              AGTTATCCATCATCTTGCGGGTTA        ACGCTTGGCTCTCTAGTGGCTTAT       
 umc1615      8.03                 AQ844362              GATGGTGGTAGGTGGAATCTGC          AAACTCCTGTGAGCTGTCTGTCG        
 umc1617      8.03                 AW129849              GATGCACCACAGTAGAGGAGGAAT        GAAGATGAGGTTCAGGAAGGACAA       
 umc1735      8.03                 AW585263              GCGCACAATATAATGAACCAACAG        TTTGCCAAAAAGACATGACACCTA       
 umc1741      8.03- 8.04           AW424565              AGACGAACCCACCATCATCTTTC         CGCTTGGCATCTCCATGTATATCT       
 umc1765      8.03- 8.04           AW331078              AGATCGTGAGGACCATCAGCAG          GAGAGATCCATCGTCAGTCGTAGC       
 umc1778      8.03                 AW424513              GTGAACCATTGTAGCTGTCCCTG         GAGCTCGTACCTGTTCATGAGGAT       
 umc1802      8.03                                       TTCCTGACAAGAAAAATATAACAGTGG     TTTCACAGTAGTGTCAGAAAGAGTTCA    
 umc1130      8.04                 AI670662              TTGGGACTCATTACTTCCGGACT         GCTAGGGGAAAGCTCGTACTATGG       
 umc1309      8.04                 AJ238507              CTCTCATTAGTTCGTGCCAGTCAA        CCAGAAATCAGAGGAAGCTCTCAG       
 umc1665      8.05                                       CAATCAGGAGCCAGGGAGATG           CTTAAACTTGTCGAGACGGTCCTG       
 umc1670      8.06                                       CCTAGGAATAAGATCGCAGGCTTT        ATTGTCGACTACAGAGAAGACGCC       
 umc1728      8.06                 AW573317              AGTACTTTCAGGCAGGGACCTTCT        AACGCACTTCTTGTAGCTGTAGGG       
 umc1384      8.07                 AI834156              GGCCTAAAACTACATGCACACACA        AGCTTATAAAGGACGGGTCGGTAA       
 umc2014      8.07                                       CATTTCACGAGCTCTAGAGAGGGA        AGTACAAGAAGGCATGGAGCTCAG       
 umc1032      8.08                 G44393                ACATTAGTTGCGTCCTTACCGAAG        GAAGCGACCATAACATGTGAGAGA       
 umc1069      8.08                 M16900                AGAGAATCCCCAAGCAAACAAAC         CTTCATCGGAGCCATGGTGT           
 umc1673      8.08                                       AAGCTCAAGCTCCTAGCTCTTCCT        GAGGAGCGTCTCCAGAAGGAC          
 umc1638      8.09                                       AGGTGACCTCGACGTCCTACG           GAGGGGAACAAAGACTTGACGTT        
 umc1663      8.09                                       GCTTGCACTAGCTTTAGCTCCATC        CGGGATCAGTCGTTACAAACATAG       
 umc1588      9.02                 AW052800              TGACAACAGCTATGTGTCTGCTCC        GGATGAAGCAAACCAAGCACATAC       
 umc1596      9.02                 AW057036              CGGCGAGGATAACATGCAGTA           TCTTGAGCTGAACACTGATCTTGG       
 umc1636      9.02                                       CATATCAGTCGTTCGTCCAGCTAa        GTACTGGTACAGGTCGTCGCTCTT       
 umc1267      9.03                 AI974888              TTACAACACGCATGCATCTAGCTT        AACAACAAAGAACTCACCAGCCTC       
 umc1420      9.03                 AI746245              AAGACGACCTCGTTTGTAGCCTC         GTATTTCAACAGCTGGGACGGT         
 umc1570      9.03                 AJ011617              CAGGAGATGATGAGCGGGAG            GTCGTAGAGGTGGTGCTGCTG          
 umc1571      9.03                 AJ011617              GCACTTCATAACCTCTCTGCAGGT        CACCGAGGAGCACGACAGTATTAT       
 umc1634      9.03                                       TCCGTTGAGGACACTCGAATTTAT        GTAGCCTGCAAAACATCCAAGAAC       
 umc1522      9.04                 AQ844644              GAGAATACTGTACCGGTCTGTCCC        GAGGAGGGGAAATAAAATGGGTAG       
 umc1771      9.04                 AW330595              CATCAGGAAGGAAGACGACTAGGA        GTGAAATGTTGTTTCCAATGCAAG       
 umc1387      9.05                 AI833929              GCTAGGTGCTTATCTCGGTTTTCA        AAGAAGCTGAACCTAAGACAGCCA       
 umc1417      9.05                 AI770379              GAATCCTGGTTGGCCTTTCC            ACAGCTGAGAACGCATTAGCAAG        
 umc1494      9.05                 AW231326              CCACAGCAGCTCAGCTCGTC            GACGACCGCTACTTCTTCAGCA         
 umc1654      9.05                                       CACATTGATCAACTACCAGGTGGA        GCCTCTTTTCTTCTCCCATTTTCT       
 umc1657      9.05                                       ATGGATGAATATGATCCCACGG          GATCCGCACGTAGCTTTTCG           
 umc1789      9.06                 AW267353              ACCTCTCCTTTTTCCTCGCCTT          GTCAGAGAAGAGGCCGGGTC           
 umc1104      9.07                 AI714928              CAACAATTCCAATCATGGCACTAA        GTAACTCTGGTGAACTCAGAGGGC       
 umc1380     10.01                 AI855154              CTGCTGATGTCTGGAAGAACCCT         AGCATCATGCCAGCAGGTTTT          
 umc1152     10.02                 AI612250              CCGAAGATAACCAAACAATAATAGTAGG    ACTGTACGCCTCCCCTTCTC           
 umc1047     10.03                                       AGGAAAGAAGGTAACCCATGCACT        GGCGAGTTAGAGGAGTCAGACACA       
 umc1648     10.04                                       CTGCAGTACGTGAGCCTGTACG          GCTTGAGCTGTGAGGAAGTTTTG        
 umc1280     10.05                 AI979671              AAAATCCATGGCTTCTTTCTTTCC        AACAGCCAGTTTTGGGCTGTATAA       
 umc1402     10.05                 AI770929              TACACGCAGCTCTGGGTTTTG           GTGATCCGGGTAGAGGAATGTG         
 umc1507     10.05                 AW181192              GATTCAAACCAAACACTTTTCCCA        CGAACCTTGCTGTGTGTTTATCAG       
 umc1678     10.05                                       GTAGAGATCGATTCGCTAACCTGC        AGTTGTTCCGTTCCGTCCTTATC        
 umc1827     10.05                                       GCAAGTCAGGGAGTCCAAGAGAG         CCACCTCACAGGTGTTCTACGAC        
 umc1898     10.05                                       ACGAGCAGCAGTCTCTTGGG            ACATGGGGCACAAGAAGCAAT          
 umc1569     10.07                 AB031012              GCAGCTCCAAGTACAGAGGTGAG         CACTGCAGACACGTAAAATCCAAG       
======================


---







More information about the Maize mailing list