New SSR Markers

Mary Polacco polaccom at missouri.edu
Mon Oct 29 22:10:01 EST 2001


The Maize Mapping Project (MMP) has kindly provided to MaizeDB 
information regarding 121 new SSR, with bin map locations for some 
117.
A brief summary file follows. Information about the SSR, with links to
external databases may be found at:  http://www.agron.missouri.edu/ssr.html

With the new data, there are now 1735 SSR markers in the public sector:
         816 have sequence accessions in GenBank.
         590 of the accessions are cDNAs,
         532 are from the Stanford EST -- Maize Gene Discovery -- Project.
A few, some 23, were mined from EST assemblies computed at TIGR.

Screening images are being loaded this week for the new SSRs.

Map details for previously mapped SSR may now be compared on 3 
mapping population using the Compare Maps Utility, listed in the 
central box on the MaizeDB homepage. Maps listed in the menu that 
display framework SSR markers, together with a handful of RFLPs:
   IBM
   Tx303xCo159
   T218xGT119

To view off-frame markers, please refer to the pdf files
on the SSR summary page: http://www.agron.missouri.edu/ssr.html.
Note: new markers do not appear on these maps.

-Mary Polacco
Curator MaizeDB
PolaccoM at missouri.edu




SSR	Bins	GenBank	PrimerF	PrimerR
----------	--------------------	-------------------- 
	------------------------------	------------------------------
umc2100	1.00	AF264877	AAAGGCATTATGCTCACGTTGATT 
	TGACGTGCAAACAACCTTCATTAC
umc2183	1.00- 1.01	BG268007	TTAGAGCATGTGGCTCTTAGTCCC 
	TCTACTGCCAAGAAGAAATCCTGG
umc2157	1.01	BG458447	GACAACGGACGTCAACCATAGC	ATCGAAGACCTCAAGGCAAAGTG
umc2096	1.02- 1.03	AF210617	AACGTACCATCCTTGTGCCTGTAT 
	CATTATTAGTACGGAGCGCTGGTC
umc2185	1.02- 1.03	BG267124	CTTCTTCTGCCACAGCACGAAC 
	CAAGGTTAAGAGCATGTACGCGAT
umc2191	1.02	BG265983	CAGGTGGTGCAGAGTTTCACAT	AAGGTGGAGGATGACTCCAAGAT
umc2097	1.03- 1.04	AF210617	AGATTTGACTGCAAGAAAAGGCTG 
	GTCCCTCGTCCTGCAAGATTC
umc2124	1.03	AX090093	ATGCGGAGGGGTCTACTACACATA 
	CTGTGTCTCACTGGAAATGACGAT
umc2145	1.03	AZ918767	GTAGTAGAGGCAGGGCTTCCAAC	TAGGAGTTCGTCAGTCAACGAGC
umc2171	1.03- 1.04	BG349843	ACATAATCCCTCGGTACAGGACAA 
	GCCCTTGTGTGTCTATTTAGGGTG
umc2112	1.04- 1.05	AZ932967	AGCTCTACCAAACACGAGCTTCAT 
	CAAATGCAGAAAGATAACGCGAAT
umc2083	1.05- 1.06	BF729374	GATGCTCAAGGAGCAGCGAC 
	CAGGTGGTACGCCATGAACC
umc2151	1.06	AZ918023	ATATGTGGTATTTTCTGCAGGCGT 
	AAAATCCTATACAGAAAACGGGCG
umc2080	1.08	BF729466	GCCAAGGTGGGTCTGGCTAT	ACCACCTTGTCCGTATCCTTCAC
umc2116	1.08	AZ932865	CGGTCGATATAATCTTGGCTGATT 
	GGCGCAGAGATCATTTGTTTAAT
umc2181	1.08	BG268724	ATCGGGTCCGGATAGATTTTACAC 
	GTAGCTAGCTTAAGCAGTGCTCCG
umc2149	1.10	AZ918211	TACATGCAAAGCTAGCTAGTCGGA 
	AGCAGCACCATCGTAATAAGCAC
umc2189	1.10	BG266144	CGTAAGTACAGTACACCAATGGGC 
	ACACCGACTACAAGCCTCTCAACT
umc2186	2.00- 2.01	BG266921	CTCCCGCAGTCTATGAAGCTCAC 
	CTCCTCTTCCTCCTCCTCGTTGT
umc2094	2.01	AF223412	TTGGAAAGTTGAGTTGACCTCCAT 
	ATCTTTGCAAGGTTGAGTTGAAGC
umc2079	2.04	BF729476	CGGCCTCGCTGTCTTCTAGC	ATGATCACGTCGTGCTGGTAGTG
umc2088	2.04	BF728075	ACGACAAGAAGGAGGCCAAAG	CAAGTAGATCGATCGAGCAGCAG
umc2125	2.04- 2.05	AZ921810	CAAGGGTAAGGGCAAGATGGTAGT 
	CTGAGGTCTACCTCGGCCATC
umc2110	2.05	BE644336	CTGCGTACTCTAGGTATCCCGTGT 
	GGTCGGATAGGAGAATCTACAGGC
umc2178	2.06	BG317183	GTATCGAGACACGTACGCACGAA	GCGCAGTGATTTCTTACCATGC
umc2129	2.07	AZ921033	ACGTGGTCATCACTCACCGC	AAGGAGGAGCGTTCTCGTGG
umc2144	2.07- 2.08	AZ918817	CCAGCCCCTATCTATTTGCTTGT 
	GAATACTATATCACGGTCGGTCGG
umc2085	2.08	BF729178	TGTACGACTTCTTCTGGACGCAC	TAGATGTCGATGTCCTCCAGGG
umc2077	2.09	BF729491	AAACTCACTGAACATGATCCTGGC 
	CTGGTTCGGATGCAAGTAGTCAG
umc2184	2.09	BG267262	CTTGGCCTACTCCAAGTTCTCG	AGTAGAGCAGCACCATCCCG
umc2102	3.00	AF298118	TCATCGATTCATCCATCTCATCTT 
	ATATTGTATAGTCTGCGGGCTTGA
umc2103	3.00	AF298118	CCTATCCATGCTTGAGGTGTCG	GTCCAGGAGGTTGTCGTCCA
umc2104	3.00	AF298118	CTGCTGGCAGTGGCAGTATTC 
	TACTGCTACACCTTTGTCGTCACC
umc2105	3.00	AF298118	ACATACATAGGCTCCCTTTTTCCG 
	TCCCGTGACACTCTCTTTCTCTCT
umc2108	3.00	AF298118	CCTTTTAATTTGCAAAGAGAGGTGG 
	CAAACTAAAGAAAGTCTCGGCAGC
umc2118	3.00	AZ932817	CGTCTCCGTCTGCAGTCACTATTA 
	TATGGTCCTCGGAGTTTGTTTGTT
umc2071	3.01	AB045772	ACTGATGGTGTTCTTGGGTGTTTT 
	ATACACGCAGTTACCCGAAGGTT
umc2107	3.01	AF298118	TGAGGTGTGGTAAAAGTGAAAGCA 
	ATCGATCTCTAGCTGCCTGCCT
umc2117	3.04	AZ932846	GTTTCATGCGTTCCAAATCACAC 
	GCAGAAGGTCGTCAGTTCTACTCTG
umc2119	3.04	AZ932610	GTCCCAAACAACAAGTGAAGGAAG 
	GTGTTGTCTGTTGGCTGTTGCT
umc2158	3.04	BG458353	ACACAGCACAACACAACACAACAC 
	AATAATTGTACCGAGATGTTGGCG
umc2127	3.05	AZ921283	TATTACCTCTCTCCGCAGCTGTA	GATGCTTCTTCTCATCACCACTC
umc2155	3.05	BG458661	CATGTGGACACCATAGACCATGA 
	CCAGAGTTAATGTGACCTAGGCGT
umc2166	3.05	BG410228	TACGTCGTACATCGCCCACC 
	GTCGTAGCCATATCAGTTGGAACG
umc2076	3.06	BF729528	CTCTCGTCATCTCACCCACTGAAC 
	CAGCCGTTGGTTACATATTTGGTC
umc2169	3.06	BG354410	ACTACTCCTCGGATAGCCACG	GACGAGTAGAGGCTCTGGGAC
umc2081	3.08	BF729464	TTTTTCCACTTGGCTGCTGG 
	CAGTTTTTCAGAAACGATTTGCCT
umc2174	3.08- 3.09	AX079856	GTACGTACGCAGCCACTTGTCAG 
	ACATAAATAAAACGTGTGCCGCAG
umc2152	3.09	AZ917975	TAGCTTCACCTGATGATCTTGCAC 
	CCTTTGTCTTCCGCTATCTTCCTT
umc2148	4.01	AZ918243	GGTAAGTCGTTTCAGCCTTTGCTA 
	AGACAGAAGAATGCTATGCGGTTC
umc2150	4.02	AZ918175	GTTGTTCACTTTCCAAAACCCTTG 
	GCCTTGTGCTTCTTGGAGTGTT
umc2082	4.03	BF729461	TAGCTGCCCCTCTTCCGTCT	GTCGTGGCGTAGAGACTAGGGAT
umc2176	4.03	BG320129	ATAGATCTTTGTCGCGTGTTCTGC 
	CTCAAGAACACCACCAGACGAGTT
umc2135	4.08	AZ920497	GTCAGTCAGTCACGAGCTGTTCTC 
	GCCTCCTTCCGTCGAGAGATA
umc2137	4.08- 4.09	AZ920094	ACCACTGCAACCTAGAGCTGTACC 
	CACTTGGGTTGTTCCACAGGAG
umc2153	4.08	AZ917952	GCCTTTTTGATTGGTGAATGCT 
	AGTACGTACAGAACGACTCCAGCC
umc2187	4.08	BG266847	GTCCACCCTACCTCTCAACAAACA 
	ACCCAACAAGTCTTAATCGGGTTT
umc2188	4.08	BG266818	CGCCAACATGATTAACTTGCTATC 
	ATTTTCAGTCTGGGTACTTGAGCG
umc2138	4.09	AZ920094	CGGGACAAGGACAGAGCAAG 
	CAGGGTAAAGCTAGACGGGTAGGTA
umc2139	4.09	AZ920029	ATAAGGAACATCCCCACCTGTTTT 
	GGTGTGCTGGGTTCTTGTGG
umc2179	5.01	BG316746	TTAACACCTCAAACAGTGATTGCC 
	GTAGAGCAGCACTCTGGGTTTCTC
umc2115	5.02	AZ932868	CTGTCTGTCTACCCAACCCAACAG 
	GGGGATAGGCGTGTGTATGTACTG
umc2132	5.02	AZ920939	GAGGCCTCAAATCGCTCTCTG	GGTCGTCAGTGAGCTGGTCC
umc2073	5.03	AX048774	GGTGGACGTGTGGTGTGTATATAGTT 
	GGAGTTGGAGGTGGAGCCTT
umc2113	5.03	AZ932924	CGTACCGTATCTCTCCACGACAG 
	GTAGGACTGTAGGAGTAGCCGCTG
umc2140	5.03	BG462680	CTAGGGTTTGCCTCTTCCCTCTC 
	AGTCTAGAGGAAGTCGGAATTGGG
umc2159	5.03	AZ916489	GTTATTTCTGAACCATGGGACTGTG 
	CTGTATGGGCTCGTATTGTCACCT
umc2161	5.03	AZ916366	ACGGCACACAGATATTTCAGTTCA 
	AAGATCAGATTTGCTTGTGGGTGT
umc2167	5.03	BG355216	AGACCGGCTAGCGCCATATC	AGTGGTGGACGAAGAGACAAGC
umc2086	5.05	BF729035	TGCCAGAGTTCTCGTTACCAA 
	CGAACAAAAACTTACAGATCCAACA
umc2111	5.05	AW157995	CACGCAACCCACTCATCACTC	CTCACCGCTCTGCTCTGCTATC
umc2164	5.05	AZ916225	AGCACACAGACAAGAGAGACAACG 
	GACCGACAACAGAGATCGAGTACA
umc2072	5.06	AX049377	TGTATTCAGAACGGCTCGTCATAA 
	GGACGGTTCCGGTTCTAAGATAAG
umc2136	5.08	AZ920322	CCAGATGCGGAAGTAGACGG	GATTCGGAGGTGATCTGACCTGT
umc2143	5.08	AZ918879	ACACACAACAGAGCCTTTTGTTCA 
	AAGAAAAGGACACCAAACCAAACA
umc2074	6.01	AX048762	ACACGGAGATGACAGACGCC 
	GTTGCCGAAGATGTTGTACTGGAT
umc2141	6.05	AZ919353	ATTAGCACCACCGTGTAGCAAGTT 
	GGCAGTGTGAGTGGTTGTGTG
umc2123	6.06- 6.07	AX090101	GTGGCGTGTCCTTTCTACGTG 
	CGAACAGCTAGCTACTGATGATGG
umc2162	6.06	AZ916284	GATGCTGATGACGCTCTACAAGG	GACGATGACGAACACCGAGC
umc2170	6.06	BG349861	CACTGCAAGCCTCTACAGACAATG 
	GAGAGTTCTCCAGGCGAGGTG
umc2165	6.07	AZ916120	AGAACACCAAATGGTGACGTTATGT 
	CTAGCTCGTCTTCCCTGTGGTCT
umc2109	7.00	AF298118	TGCACGCATTATTGTGTGTACTGA 
	CCATGGCTTCACTAAAACATCTCC
umc2177	7.00	BG319797	ACCATGCATGTCTCACGTCACT	GGGTACGTGCTGTGGAGGAC
umc2160	7.01	AZ916481	TAAAACCTTTACCCCATCCAGCAT 
	TGTGCTCGTGCTTCTCTCTGAGTA
umc2092	7.02	AX046673	GCACAACCTACTCGCTACCTTACC 
	ATCGTACTACTCCACTTGCTTGGC
umc2098	7.02	AF244701	GGTGAACAAGATCTCTTTGTCTACTGT 
	CCTTCTCGGCCATTATTGCT
umc2142	7.02	BG462268	ATGGATCAGGGGAAAGAGCAA	CCTCCTCGTCCTCCTTCTTGAT
umc2190	7.06	BG266078	GATCCGTTGAGGTCGATCCTTT 
	GAGGAGTTCCTGCAGTTTCTTGAC
umc2075	8.03- 8.04	AX048738	CCTGGTATCTTGATGAGCTGGATT 
	AGAAACATGTCCGGTTCTTCAGAC
umc2146	8.03	AZ918316	GTCTCCGTCCACCTCCTGTG	GTCATGGGAATGTGCTGGATG
umc2147	8.03	AZ918316	CTACCCCTACGGCATCACCTACTT 
	AGACGGAAATGCACCGAGAAG
umc2173	8.03	BG349076	TTCAAAGATCCAGTCAGCAATAAGG 
	GAACGTGACGCTCTACATGCTG
umc2154	8.04	BG458963	GCTAGTAGTAGTTCCAACGAAGCAACA 
	GTCACCATCTCCAGGTGCAAGT
umc2182	8.04- 8.05	BG268356	TTCTACCTCCTATCATCGTCCTCG 
	GAAGAGGAGGAAGTCGACGAGTG
umc2175	8.05- 8.06	BG320980	TACTCCTCGCATTCACATATCGGT 
	CTTCCTCGTATGGGAAACTTAGCC
umc2089	9.00	BF727920	CAGGAAGAGGAAGAAGGGTCCTC	GCCAGCTCTACGGCCTATGAC
umc2131	9.00	AZ920955	CCATAGTAGTGGGGACAGGTTCAT 
	AGAAACGGCAAATAATGCTGTCAT
umc2078	9.01- 9.02	BF729485	TTTTTGTGCTCGTCTGATTTCTTG 
	AGACCAATGCAACTCCTACAGACC
umc2084	9.01	BF729356	ATCGCGACGAGTTAATTCAAACAT 
	TACGATGTCTTCAGTGTGACACCA
umc2093	9.01- 9.02	AF296123	GAAAATGAAGAATAGGAGACATTGTTGC 
	ATGCACATGCAGTTCCTTGGTTAT
umc2128	9.02- 9.03	AZ921231	CACGGGGAATTCTCATATAGCAAG 
	GAGTGTGTACGTAGGTATGCCCG
umc2130	9.02	AZ921010	CGAGTTACCTTTGGCACTAGCACT 
	ATCATGACGTATCTTTCCGAGAGC
umc2087	9.03	BF728356	GTGCTGGCTGAAGAGTTTTACTGG 
	CTACGGTTAGCTCGCTCGTCTAAG
umc2168	9.03	BG354412	AGAGCCTCTCGGAGATAAGAAGGA 
	GTGCATACCCACCACCTCGTAG
umc2120	9.04	AZ932600	ACGTCAAGTAGTGAATCCTGCTCC 
	ATTCTCCGCGGAAGAGACAAG
umc2121	9.04	AZ932511	AAAAGTGGGCGCTAGTACAAGATG 
	GTGGTGTTCTCCTTTTGATACGCT
umc2095	9.05	AF210618	GTGCTGGTTGTGCATGGTATATTG 
	CCATGCATGACGCAAGTCTCT
umc2133	9.05	AZ920800	TTCAGGTGTGCACTGACTCTGACT 
	ATGCTCAAGCTCAACAGCACTTC
umc2134	9.05	AZ920516	TAGTCTAGCGTCGACGAAAAATGC 
	CAGGCGACGAAGATGAATTGAA
umc2099	9.07	AF244678	AGGTCATCAAGATGCAGAGGGAG	TCAAGGTACGAAGCCTGACGAC
umc2114	10.02	AZ932886	ACATGGTTCGTGATATTTTCCCAG 
	CGTCGTTCACCACAATAATGAGAA
umc2180	10.03	BG316573	ATCAGCATCGATAGCGAAGAAAGA 
	ATTGCTACTAGGGTTGTTGTTGCC
umc2156	10.04-10.05	BG458572	ACGACGGCAAGAAGAAAACTACTG 
	CGACCTGCTTTCAGTCTCTCTAGC
umc2163	10.04	AZ916248	AAGCGGGAATCTGAATCTTTGTTC 
	GAAATTGCTGGGGTTCTCATTTCT
umc2122	10.07	AF326509	TTGACAAGCTAGTGTGCAACTGTG 
	TGAAAGCCCACTGGACAAACTAAT
umc2126	10.07	AZ921783	CAGTTCTGCACTTCTGCTTGCTC	AGGACTGTGAAGAGCGCGAG
umc2172	10.07	BG349450	AGTAATCTCATGCCCGCTCTTCTT 
	TACGCTGAGTCAAAAACCAGGAAT




More information about the Maize mailing list