Is My Sequence Mapped?

Ed Coe CoeE at missouri.edu
Fri Dec 6 22:36:47 EST 2002


Maize Sequence Searchers!
The Mapped Sequence Locator (MSL) will show whether your 'favorite
sequence' has been mapped genetically, and will give links to maps it is
on, to contigs in FPC, and to GenBank, ZmDB, TIGR, and Gramene (matches
to rice/grass sequences).  The GenBank resource is current to 5 Dec
2002.  If you have not used MSL, or if you have had trouble in the past,
go to
http://www.maizemap.org/cgi-bin/zmMSL.cgi

We would greatly appreciate any feedback from you, by email to me.
    Thanks.
Ed Coe

Some sample sequences to test out, one at a time or all at once (SSR
primers from a few genes):

ATTCATTCAGGTCGAACAAAGTGG
CCCGAGGATCTCGTAGTACTTGGT
GGCAGAGAGATGAAAAAGAATGGA
GAAAACTGCATCAACAACAAGCTG
CAACGCGAAAGCCAAAACCTCTTC
CGGAAAGACGTGATCAAACACTGC





More information about the Maize mailing list