pcr primers

[suter at VAX.MPIZ-KOELN.MPG.dbp.de]

Subj:	Restriction near DNA ends
=========================================================================
+  I'm preparing to do a PCR and I've had some very good suggestions from
+this group in terms of how to sequence the PCR product.
+  If I go the route of adding restriction sites at 5' ends of the primers,
+I can directionally clone the PCR fragment into a plasmid.  One
+possibility I considered was to add EcoR I and Hind III ends to to my
+primers, but someone here mentioned that Hind III will not cut a site
+with >10 additional bases.  He cited data on "Cleavage Close to the End
+of DNA Fragments" on p 182 of the New England Biolabs Catalog, 1992.
+  Based on this data, I won't add a Hind III site since I don't want to
+add an additional 12 bases on top of it.  Having said that, does anyone
+know if the data in this table is really applicable to the PCR situtation
+since 3' of the site will be hundreds of bases instead of the 8, 10, and
+12 bases fragments tested by Biolabs?
+  Can someone please send a small list of restriction enzymes they know
+will cut near a DNA end, and what is the recommended amount of spacer DNA
+to add to the end.
+  Thanks very much in advance for your advice.
+
+  Dan Meier
+  DMEIER at mis.mcw.edu

dear dan,

i've had similar thoughts/problems a few years back. i believe the table in the
catalogs are ok, but i suspect taq polymerase may also block the end of the
pcr product, so the enzyme can not reach it.

i have been designing my oligoes for the past years as follows:

target sequence :	atgatagatagatagatagagggctcgcgatcgcgatcgatcgatcgat
oligo needed:		                  gagggctcgcgatcgcgatcgatcga
with added site:	          ggggatccgagggctcgcgatcgcgatcgatcga
my oligo:				  gagggctcgcgatcgGgatcCatcga
                                                         +    +

note that through two base changes a BamHI site is formed, pretty far
away from the 5' end of the oligo. this oligo probably anneals more
specific than the one above it, since it does not contain 8 extra 
nucleotides. i use these oligos standardly, all work ok in race and pcr AND
the products are readibly clonable.

so hip it hurts,

clemens
===============================================================================
Clemens Suter-Crazzolara, PhD
Max-Planck-Institut fuer Zuechtungsforschung
Abteilung Genetische Grundlagen der Zuechtungsforschung
Carl-von-Linne Weg 10
5000 Koeln 30
Tel. xx49-221-5062.221           fax. xx49-221-5062.21
suter at vax.mpiz-koeln.mpg.dbp.de
===============================================================================