Northern - prehybr.

[Andre Hamel]

In article <kaijalainen.2 at viikki.Helsinki.FI> kaijalainen at viikki.Helsinki.FI (SEPPO KAIJALAINEN (MMETT)) writes:
>My problem is the backround signal when I have total-RNA (5-10 ug,UV 260nm) 
>on the nylon (Boehr. +++). The RNA is denatured with Glyoxal/DMSO. According 
>to my results with 1X oligo-dT selectedRNAs on the filters (nice bands in 15 
>min after adding the colour sol'n with DIG-labeled RNA-probes) the target 
>should be high copy-No mRNAs (several cDNA-clones as probes). With the 
>totRNAs the whole area  where you could think RNA to exist, is purple, with 
>the sense AND the antisense-probes. Sometimes the smaller rRNA-band remains 
>white like the rest of the filter. The pattern is similar with 32P-random-
>primed ds-probe (4X 10 to 8 cpm/ug, 500 000 cpm/ml ofhyrd.sol'n) although it 
>takes O/N to appear. I've used two different prehyb-hyb-buffers;The one 
>suggested by Boehringer and the other: 0.1 M Phosphate pH 7.2, 7% SDS, 5mM 
>EDTA,50% deion. Formamide, 50 ug yeast-RNA/ml in all sol,ns, 68o C, 
>prehybridization 6-20 h. The high stringency wash is 40 mM P-buffer, 1% SDS,
>5 mM EDTA, 2X 1/2 h 68oC. I find preparation and quantitation ofpolyA-RNA 
>frustrating, and would like to use totals instead. If there is anyone who 
>recognizes the problem, and could advise -help !
>
>                           S.K.


Are your cDNA probes cloned in any of Strategene's pBluescript vectors? If
so, I suggest either subcloning into other vector or simply remove (if
possible) the region in the vectors multiple cloning site inbetween the
Sac I and Xba I sites (the sequence around and including the Not I site
causes HORRENDOUS background/false signals in northerns, in situ hyb'ns
with BOTH sense AND antisense probes ... if using other vectors for your
cDNA probes then perhaps similar/same sequence is at "fault" ...
especially "notorioous" when RNA probes {riboprobes} are used ...  the
sequence by the way is as follows:

5' CCGCGGTGGCGGCCGCTCTAGA 3'
   Sac I  Not I    Xba I

regards, Andre
                            ********************
Andre Hamel                                 email: hamel at ccu.umanitoba.ca
Manitoba Veterinary Services                lab tel.: (204) 945-7630
Infectious & Genetic Disease                     FAX: (204) 945-8062     
Mol.Biol.Lab., Winnipeg, Manitoba, CANADA
                            ********************