Interrupted reading frame, help!

chai_z at wehi.edu.au chai_z at wehi.edu.au
Tue Apr 12 22:43:55 EST 1994


Hello there,

I'm cloning an insulin or insulin-realated genes from a mollusc. I pulled out
a cDNA using oligo probe of a reference sequences. My sequence showed 87%
homology with the reference sequence, but by taking away 4 bases in the middle.
The extra bases interrupted the reading frame. Furthermore, the whole cDNA 
(1488 bases) contained many stop codons, which resulted in very short reading 
frames (the biggest one is about 70 aa). 

	My questions are:

A. Is it possible that a pre-mRNA has been cloned? How to identify it?
B. Is there any reason for me to take away the 4 extra bases (GACA or ACAG) 
in my sequence, for example, as inserted fragment during the evolution or 
during the laboratory process?

BTW, the sequencing autoradiograph showed crystal clear bands and the seq.
has been confirmed by sequencing from both strand.

The following is the comparison of my seq. to the reference seq.

            Quality:   17.2             Length:     35
 Percent Similarity: 87.097   Percent Identity: 87.097

 Mips-C2.Seq x Mipi.Embl   March 23, 1994  15:48  ..

                       CysGluCysCys       LysProCysThrLeu
                       ---```---```       ---```---```---  .         .     
  my sequence    1115 GTGTGAATGCTGTTTGACAGAAACCGTGTACATTG 1149
                      ||||||||||||  |    ||||||||| ||| ||
  reference       410 GTGTGAATGCTGCAT....GAAACCGTGCACACTG 440
                       ---```---```--    -```---```---```
                       CysGluCysCysMet    LysProCysThrLeu

Any comments are appreciated.

Zhonglin Chai
Melbourne
(chai_z at wehi.edu.au)



More information about the Methods mailing list