Annealing Temperatures for PCR

Brian Foley brianf at med.uvm.edu
Sun Aug 14 07:01:26 EST 1994


rosas at mcclb0.med.nyu.edu wrote:
: Hi

: Primer       5'   cttctttcagctggattctaatttaaag    3'
: Template     5'   CTTCTTTTCGCTGGATTCTAATTTAAAG    3' 
:                          --

: I have already done some PCRs using different ATs, but all of
: them have given me very low yield of my PCR product...

    I think you'll be making a significant amount of product
from the following hybridization:

Primer       5'   cttctttcagctggattctaatttaaag    3'
Primer            3' gaaa                 tttcttc 5'
                         tttaatcttaggtcgac

	This will add an extra AAG to the 3' end of the primers
in early rounds.
	Now you'd think that just a few bases of anealing at
the 3' end would not work...  But it does due to the 
very high concentration of primers in the early rounds.
	Perkin-Elmer used to include a set of "test" primers
with their PCR kit which had only a 2 base complementarity
at the 3' end in order to show how much "primer dimer"
such a problem can cause.

	If you are making any such product, it may not appear as
a "primer-dimer" band on a gel, because it will not be a true
full length ds-DNA primer dimer, but rather will be single stranded
and jut have 3 extra bases (AAG) on its 3' end.

	You could start with low level of this primer and
then add in more after 8 or 10 cycles, when the concentration
of the template has increased so that the ratio of primer
to template is not so high.  I've never tried this so
I don't know if it will work, but "in theory" :)  it should.

--
********************************************************************
*  Brian Foley               *     If we knew what we were doing   *
*  Molecular Genetics Dept.  *     it wouldn't be called research  *
*  University of Vermont     *                                     *
********************************************************************



More information about the Methods mailing list