Need sequence of pT7-7

Tracy Aquilla aquilla at salus.med.uvm.edu
Thu Dec 29 11:47:40 EST 1994


In Article <Pine.3.85.9412290849.A2796-0100000 at altis>,
slawek at ALTIS.CHEM.PG.GDA.PL (Slawek Dabrowski) wrote:
>
>
>If you get it, please send me it :) too.
>
>                        regards
>                                slawek at altis.chem.pg.gda.pl
>
>
>On 29 Dec 1994, Zhixiang Hu wrote:
>
>> Does anyone out there has the DNA sequence of plasmid pT7-7? It is not in
>> genebank.
>> Thanks!
>> 
>> email: xiang at scripps.edu
>> 
>> 
>

Here it is. No guarantees.

AAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGAT
CTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCC
CCATGGCTGCAATGATACCGCGAGAACCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCC
GAGCGCGGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATAAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTC
GCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTGGGTATGGCTTCAT
TCAGCTCCGGTTCCCAACGATCAAGGCGAGATACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT
CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCAATCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCAT
GCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATGATGTATGCGGCGACCGAGTT
GCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATGGGAAAACGTTCT
TCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTC
AGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGA
CACGGAAATGTTGAATACTCATACtcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcgga
tacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtcta
agaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtcttcaagaatTAAAAGGAT
CTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGGCTCAGACCCCG
TAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTA
CCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACC
AAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGC
TAATCCTGTTACCAGTGGCTGCTGCCGATGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGAT
AAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA
CCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCG
GAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGA
CTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTT
CCTGGCCTTTTGCTGGCCTTTTGCTAACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACAGCAT
TTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAAGAAGCGGAAGAGCGCCTG
ATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGagatctGTGCACTCTCAGTACAATCTGCTCTGATGC
CGCATAGTTAAGCCAGTATATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGAAACCCGCCAACACCC
GCTGACGCCCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTG
TCAGAGGTTTTCACCGTCATCACCGAAACGGCCGAGGCCCAGcgattcgaacttctgatagacttcgaaattaatacgac
tcactatagggagaccacaacggtttccctctagaaataattttgtttaactttaagaaggagatatacatatggctaga
attcgcgcccggggatcctctagagtcgacctgcagcccaagcttatcgatGATAAGCTGTCAAACATGAGAATT

Tracy Aquilla, Ph.D.
Molecular Physiology and Biophysics
University of Vermont
aquilla at salus.med.uvm.edu



More information about the Methods mailing list