Salmon vs. Herring Testes

[Stanley Tahara]

In article <2m2dto$kia at nermal.cs.uoguelph.ca> rgiroux at uoguelph.ca (Randal W Giroux) writes:
>
>I have a fridge full of Herring Testes DNA (Sodium salt) from sigma. We
>are currently using the SAlmon testes version in our Southerns but wonder
>if we might use up the Herring Version. Is there a difference. A short
>investigation showed both have the same CAS number in the Sigma catalogue.
>Any insight would be appreciated. Does one function better than the other?
>If not why is Herring cheaper in the Sigma Catalogue?? Thanks in advance..
>
>
>

We had a similar question a few years back.  In our hands we had
very poor luck with the herring DNA.  It appeared that it had been
extensively degraded before we even got a chance to shear it. I see
no reason why herring DNA shouldn't be okay, providing it is of high MW.
We probably got a bad batch from Sigma. As a result of this we 
alway buy the Salmon sperm DNA.

Hope this is useful.

-- 
|Stan Tahara                   Dept. of Microbiology            |    
|Phone:   (213)-342-1722       USC School of Medicine           |
|FAX:     (213)-342-1721       stahara at xlate.hsc.usc.edu        |
*********** AGUACUGCUAAUUUAGAUUAU ACUGCCCAUGCACGUGAG*************